Layout: | |
Zoom | |
|
Trait (count=11) | Type | Name | LOD score | Position | Description | ||
---|---|---|---|---|---|---|---|
AT4G03445 | gene | MIR447A | 4.41 | 4:01528134 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG | ||
AT5G05987 | gene | PRA1.A2 | 3.38 | 5:01804697 | prenylated RAB acceptor 1.A2 (PRA1.A2)%3B CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895)%3B BEST Arabidopsis thaliana protein match is: Cysteine/Histidine-rich C1 domain family protein (TAIR:AT3G11402.2)%3B Has 291 Blast hits to 291 proteins in 80 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 162%3B Fungi - 6%3B Plants - 119%3B Viruses - 0%3B Other Eukaryotes - 4 (source: NCBI BLink). | ||
AT3G05905 | gene | -3.02 | 3:01760905 | Potential natural antisense gene%2C locus overlaps with AT3G05900 | |||
AT5G52760 | gene | -3.04 | 5:21386727 | Copper transport protein family%3B BEST Arabidopsis thaliana protein match is: Heavy metal transport/detoxification superfamily protein (TAIR:AT5G52750.1)%3B Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 736%3B Fungi - 347%3B Plants - 385%3B Viruses - 0%3B Other Eukaryotes - 339 (source: NCBI BLink). | |||
AT5G47020 | gene | -3.13 | 5:19081458 | unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11700.2)%3B Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 736%3B Fungi - 347%3B Plants - 385%3B Viruses - 0%3B Other Eukaryotes - 339 (source: NCBI BLink). | |||
AT3G14640 | gene | CYP72A10 | -3.25 | 3:04919757 | putative cytochrome P450 | ||
AT3G24615 | gene | -3.33 | 3:08979504 | Encodes a Z43 snoRNA. Gb: AJ240080 | |||
AT1G62060 | gene | -3.37 | 1:22941569 | unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: endomembrane system%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62220.1)%3B Has 386 Blast hits to 125 proteins in 33 species: Archae - 6%3B Bacteria - 295%3B Metazoa - 8%3B Fungi - 17%3B Plants - 46%3B Viruses - 0%3B Other Eukaryotes - 14 (source: NCBI BLink). | |||
AT5G02470 | gene | DPA | -3.41 | 5:00542318 | core cell cycle genes | ||
AT4G04650 | gene | -3.44 | 4:02353989 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein%3B CONTAINS InterPro DOMAIN/s: RNA-directed DNA polymerase (reverse transcriptase)%2C related (InterPro:IPR015706)%3B BEST Arabidopsis thaliana protein match is: RNA-directed DNA polymerase (reverse transcriptase)-related family protein (TAIR:AT1G43730.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink). | |||
AT2G43390 | gene | -4.06 | 2:18020229 | unknown protein%3B Has 7 Blast hits to 7 proteins in 3 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 7%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink). |