Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion.
JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT4G25320.1); Has 865 Blast hits to 854 proteins in 59 species: Archae - 0; Bacteria - 11; Metazoa - 37; Fungi - 23; Plants - 764; Viruses - 14; Other Eukaryotes - 16 (source: NCBI BLink).
Putative homolog of the Blind gene in tomato. Together with RAX2 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB37, regulates axillary meristem formation. RAX1 is expressed in a small central domain within the boundary zone separating SAM and leaf primordia during early leaf primordium development and is currently the earliest spatial marker for future axillary meristems. Member of the R2R3 factor gene family.
Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment.
Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein).
predicted to encode a protein with an N-terminal PHD domain and two RING domains surrounding an SRA domain. Attempts to isolate ORTH3/VIM5 cDNA through RT-PCR were unsuccessful and only one Arabidopsis EST is associated with this locus. A paternally expressed imprinted gene.
encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to the nucleus.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance.
Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified.
Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression.
Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality.
Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid.
Encodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to the plastid and not the nucleus.
Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression.
Encodes GL1, a Myb-like protein that is required for induction of trichome development. Interacts with JAZ and DELLA proteins to regulate trichome initiation.
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes.
ING2 encodes a member of the Inhibitor of Growth family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.
Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities.
Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two.
Homeodomain protein (PRHA). Expression of the gene differs in various vegetative and floral plant tissues and is positively influenced by the phytohormone auxin. It is often associated with regions of developing vascular tissue. The prha promoter is highly responsive to the synthetic auxin, naphthalene acetic acid, in transient assays using tobacco protoplasts. The PRHA protein has the capacity to bind to TAATTG core sequence elements but requires additional adjacent bases for high-affinity binding.
Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY.
Encodes IDN2 (INVOLVED IN DE NOVO 2), a double-stranded RNA-binding protein involved in de novo methylation and small interfering RNA (siRNA)-mediated maintenance methylation. IND2 is a component of the RNA-directed DNA methylation pathway.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT2G33620.4); Has 3258 Blast hits to 2940 proteins in 204 species: Archae - 0; Bacteria - 25; Metazoa - 1636; Fungi - 293; Plants - 789; Viruses - 3; Other Eukaryotes - 512 (source: NCBI BLink).
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT5G24050.1); Has 142 Blast hits to 142 proteins in 6 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 140; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions.
Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c.
Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress.
HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain.
Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC)
Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis.
Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing.
Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages.
LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family.
LAF1 is a R2R3-MYB transcription factor and positive regulator of the phyA photoresponse. Interaction of LAF1 with HFR1 stabilize the proteins against ubiquitination by COP1(AT2G32950) and subsequent degrations. Mutants have an elongated hypocotyl specifically under far-red light but retain wild-type responses to other light wavelengths.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower.
encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
Encodes a nuclear protein that is expressed rhythmically and interacts with phytochrome B to control plant development and flowering through a signal transduction pathway. Required component of the core circadian clock regardless of light conditions.
encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated.
Encodes a member of the R2R3 MYB transcription factor gene family that is required for anther development by regulation tapetum development, callose dissolution and exine formation. It acts upstream of MS2.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
This gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation. Its expression is regulated during cell cycle progression through E2F transcription factors.
Zinc finger C-x8-C-x5-C-x3-H type family protein; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: CCCH-type zinc finger family protein (TAIR:AT2G19810.1); Has 726 Blast hits to 700 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 157; Fungi - 3; Plants - 406; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT5G24050.1); Has 152 Blast hits to 151 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 152; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation.
ovate family protein 6 (OFP6); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: Ovate family protein (TAIR:AT2G36026.1); Has 453 Blast hits to 451 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 453; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a member of the auxin response factor family. ARFs bind to the cis element 5'-TGTCTC-3' ARFs mediate changes in gene expression in response to auxin. ARF's form heterodimers with IAA/AUX genes. ARF1 enhances mutant phenotypes of ARF2 and may act with ARF2 to control aspects of maturation and senescence.ARF1:LUC and 3xHA:ARF1 proteins have a half-life of ~3-4 hours and their degradation is reduced by proteasome inhibitors. 3xHA:ARF1 degradation is not affected by a pre-treatment with IAA. A nuclear-targeted fusion protein containing the middle region of ARF1 linked to LUC:NLS has a similar half-life to the full-length ARF1:LUC construct. The degradation of 3xHA:ARF1 is not affected in an axr6-3 mutant grown at room temperature, although the degradation of AXR2/IAA7 is slowed under these conditions.
Domain of unknown function (DUF313) ; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G27410.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl.
Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation.
myb family transcription factor, contains Pfam domain, PF00249: Myb-like DNA-binding domain l; also isolated as a putative cytoskeletal protein in a yeast screen
Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin.
Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2. Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses.
Encodes a putative transcription factor (MYB88), involved in stomata development, double loss of MYB88 and FLP (MYB124) activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants over the single mutant flp phenotype.
Encodes a histone deacetylase. Controls the development of adaxial/abaxial leaf polarity. Two lines with RNAi-directed against this gene show reduced Agrobacterium-mediated DNA transformation of the roots.
Encodes the VIM3/ORTH1 protein that is similar to VIM1. This protein has an N-terminal PHD domain and two RING domains surrounding an SRA domain. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. This protein functions as an E3 ubiquitin ligase in vitro with members of the UBC8 family E2s. Either of the two RING domains present in the protein can promote ubiquitylation in vitro, but, not the PHD domain. Over-expression of ORTH1/VIM3 leads to decreased levels of FWA methylation, increased levels of FWA transcripts, and delayed flowering. Cen180 repeats are also hypomethylated in plants overexpressing this protein.
Arabidopsis thaliana homolog of human CAND1 (cullin-associated and neddylation-dissociated). Putative similarity to TBP-interacting protein TIP120. Ubiquitously expressed in plant tissues throughout development. T-DNA insertion mutant plants were completely sterile and resistant to sirtinol and auxin, but not to gibberellins or brassinolide. Displayed developmental phenotypes similar to those of axr1, namely, short petioles, downwardly curling leaves, shorter inflorescence. Required for SCF function and appears to modulate SCF complex cycling. Physically interacts with CUL1.
DNA binding with one finger 2.4 (DOF2.4); CONTAINS InterPro DOMAIN/s: Zinc finger, Dof-type (InterPro:IPR003851); BEST Arabidopsis thaliana protein match is: OBF-binding protein 3 (TAIR:AT3G55370.2); Has 1447 Blast hits to 1391 proteins in 103 species: Archae - 4; Bacteria - 20; Metazoa - 104; Fungi - 10; Plants - 1085; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).
Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth.
Type I member of MADs box domain transcription factor family. This class lacks the K-domain required for dimerization that is characteristic of class II MADS box proteins.
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5.
Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number.
Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal.
Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions.
Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin.
Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture.
Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation.
Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression.
Encodes an AP2/ERF protein, is expressed in a subdomain of meristem stem cells, in lateral organ anlagen, and transiently in the distal domain of organ primordia. It is a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ESR1). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Can confer cytokinin-independent shoot formation and causes severe meristem defects when overexpressed in Arabidopsis root explants. Involved in controlling embryogenesis and embryo patterning by interaction with PHAVOLUTA.
Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
Encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal
Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts.
Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5B) and expressed in vegetative and reproductive tissues
encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation.
A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices.
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development.
Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA but not phyB.
Domain of unknown function (DUF313) ; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G24670.1); Has 82 Blast hits to 82 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth.
Encodes an inositol polyphosphate 3-/6-/5-kinase that is localized to the nucleus. Able to complement a mutation in a yeast transcriptional regulator gene (ARG82/IPK2).
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-3). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM.
Encodes protein with TCP (TB1,CYC,PCF) domain which is likely to be involved in DNA binding and protein-protein interactions. Based on genome analysis, there is a 9-member gene family that possesses this domain in Arabidopsis. Orthologue of Antirrhinum gene CYCLOIDEA.
Encodes a nuclear protein that can bind DNA in a sequence specific manner and is involved in seed coat development and shoot branching. It has been shown to activate transcription of a target gene, AtEXPA9.
Encodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment.
HSI2 is a member of a novel family of B3 domain proteins with a sequence similar to the ERF-associated amphiphilic repression (EAR) motif. It functions as an active repressor of the Spo minimal promoter (derived from a gene for sweet potato sporamin A1) through the EAR motif. It contains a plant-specific B3 DNA-binding domain. The Arabidopsis genome contains 42 genes with B3 domains which could be classified into three families that are represented by ABI3, ARF1 and RAV1. HSI2 belongs to the ABI3 family. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50µM ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain.
Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower
encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels.
Encodes a GATA transcriptional regulator required to position the proembryo boundary in the early embryo. Regulates shoot apical meristem and flower development.
Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals.
Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing.
Encodes transcription factor involved in photomorphogenesis. Regulates gibberellin biosynthesis. Activated by AGAMOUS in a cal-1, ap1-1 background. Expressed at low levels in developing stamens. Increased levels of ATH1 severely delay flowering in the C24 accession. Most remarkably, ectopically expressed ATH1 hardly had an effect on flowering time in the Col-0 and Ler accessions. ATH1 physically interacts with STM, BP and KNAT6 and enhances the shoot apical meristem defect of some of these genes suggesting a role in SAM maintenance. Nuclear localization is dependent upon interaction with STM.
Encodes a novel transcriptional regulator, a calcium-dependent lipid-binding protein containing a C2 domain, that binds specifically to the promoter of THAS1 (thalianol synthase 1). It can bind ceramide and is involved in drought and salt tolerance.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower.
Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling.
wound-responsive family protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77310.1); Has 560 Blast hits to 534 proteins in 143 species: Archae - 0; Bacteria - 34; Metazoa - 261; Fungi - 64; Plants - 78; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink).
Encodes glutaredoxin ROXY2. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen.
Involved in the promotion of the transition of the vegetative meristem to reproductive development. Four forms of the protein (alpha, beta, delta and gamma) are produced by alternative splicing. Involved in RNA-mediated chromatin silencing. At one point it was believed to act as an abscisic acid receptor but the paper describing that function was retracted.
AGL12, AGL14, and AGL17 are all preferentially expressed in root tissues and therefore represent the only characterized MADS box genes expressed in roots.
Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell proliferation during leaf and flower development. Loss of function mutations have narrow, pointed leaves and narrow floral organs. AN3 interacts with members of the growth regulating factor (GRF) family of transcription factors.
Arabidopsis protein of unknown function (DUF241); LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF241, plant (InterPro:IPR004320); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01590.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate.
bZIP17 appears to regulate transcription as part of a salt and osmotic stress response. zip17 mutants show enhanced inhibition of primary root elongation in response to NaCl. Several salt-responsive genes, such as ATHB-7 show a reduced transcriptional response to a salt treatment in zip17 mutant seedlings. myc:bZIP17 undergoes proteolytic processing in salt-treated wild type seedlings, but not in s1p-3 (subtilase) mutants and there is also evidence for S1P-mediated cleavage of bZIP17 in vitro. In addition, an mGFP:bZIP17 protein moves from the ER to the nucleus following salt treatment.
Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root.
Identified in an enhancer trap line; member of the NAC family of proteins. Expressed at the boundary between the shoot meristem and lateral organs and the polar nuclei in the embryo sac.
May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells.
Transcription factor of the B-ZIP family that has high affinity for C-box motifs. Interacts with NPR1 and may regulate PR gene expression. Phosphorylated by a CK2-like protein in vitro. Phosphorylation is enhanced by salicylic acid treatment.
encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
unknown protein; BEST Arabidopsis thaliana protein match is: Arabidopsis protein of unknown function (DUF241) (TAIR:AT4G35680.1); Has 1908 Blast hits to 1345 proteins in 175 species: Archae - 3; Bacteria - 106; Metazoa - 494; Fungi - 346; Plants - 115; Viruses - 71; Other Eukaryotes - 773 (source: NCBI BLink).
Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3).
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing.
Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes.
sequence-specific DNA binding transcription factors; BEST Arabidopsis thaliana protein match is: Basic-leucine zipper (bZIP) transcription factor family protein (TAIR:AT2G21230.1); Has 75 Blast hits to 75 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 2; Other Eukaryotes - 0 (source: NCBI BLink).
Surfeit locus protein 5 subunit 22 of Mediator complex; FUNCTIONS IN: RNA polymerase II transcription mediator activity; INVOLVED IN: regulation of transcription from RNA polymerase II promoter; LOCATED IN: mediator complex; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit Med22 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: Surfeit locus protein 5 subunit 22 of Mediator complex (TAIR:AT1G07950.1); Has 238 Blast hits to 238 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 161; Fungi - 12; Plants - 53; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
An extragenic dominant suppressor of the hy2 mutant phenotype. Also exhibits aspects of constitutive photomorphogenetic phenotype in the absence of hy2. Mutants have dominant leaf curling phenotype shortened hypocotyls and reduced apical hook. Induced by indole-3-acetic acid.
Transcriptional co-activator. Essential for the developmental switch from cell proliferation to cell differentiation in response to variations in auxin and cytokinin concentrations.
Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense.
Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to dessication due to the abnormal cuticle.
sequence-specific DNA binding transcription factors; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57780.1); Has 151 Blast hits to 151 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT3G24850.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
putative transcription factor of the R2R3-MYB gene family. Transcript increases under conditions that promote stomatal opening (white and blue light, abi1-1 mutation) and decreases under conditions that trigger stomatal closure (ABA, desiccation, darkness), with the exception of elevated CO2. Expressed exclusively in guard cells of all tissues. It is required for light-induced opening of stomata. Mutant shows reduced stomatal aperture which helps to limit water loss during drought.
Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses.
Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation.
Encodes a nuclear dsRNA-binding protein DRB4 that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. Also has an impact on polymerase IV-dependent siRNA levels. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.
encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
encodes a basic leucine zipper G-box binding factor that can bind to G-box motifs only as heterodimers with GBF2 or GBF3. A single amino acid change can confer G-box binding as homodimers.
Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides.
vascular plant one zinc finger protein (VOZ1); BEST Arabidopsis thaliana protein match is: vascular plant one zinc finger protein 2 (TAIR:AT2G42400.1); Has 77 Blast hits to 70 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a polypeptide that contains FCPH and BRCT domains. RNAi suppression mutant lines were generated, which displayed a range of phenotypic abnormalities, including: incomplete to no cotyledon expansion, slow growth, epinastic leaves or small inflorescences.
YABBY gene family member, likely has transcription factor activity, involved in specifying abaxial cell fate. Along with FIL, involved in patterning of the fruit. GUS reporter gene expression in seedlings is observed in the young leaves and as the leaf matures, expression is restricted to the abaxial tissues of leaves, expression is also observed on either side of the leaf margin in the younger tissues of leaf blades.
JMJD5 encodes a protein which contains a jumonji-C (jmjC) domain. jmjd5 mutant plants have a short-period circadian phenotype. JMJD5 has histone demethylase activity and interacts with EFM to repress FT.
Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage.
PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. Acts as transcriptional repressor of CCA1 and LHY.
B-box type zinc finger family protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: B-box type zinc finger family protein (TAIR:AT5G54470.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
Encodes a calmodulin-binding protein CBP60g (calmodulin binding protein 60-like.g). The calmodulin-binding domain is located near the N-terminus; calmodulin binding is dependent on Ca(2+). Inducible by both bacterial pathogen and MAMP (microbe-associated molecular pattern) treatments. Bacterial growth is enhanced in cbp60g mutants. cbp60g mutants also show defects in salicylic acid (SA) accumulation and SA signaling.
Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
Encodes BZS1, a brassinosteroids-regulated BZR1 target (BRBT) gene. BZS1 is a putative zinc finger transcription factor. Expression of BZS1 was increased under BR-deficient condition and repressed by BR. Transgenic Arabidopsis plants overexpressing BZS1 showed a hypersensitivity to the BR biosynthetic inhibitor brassinazole (BRZ). In contrast, transgenic plants expressing reduced level of BZS1 had longer hypocotyls than wild type when grown on BRZ.
Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.
Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB38, regulates axillary meristem formation.
Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis.
Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum.
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
Encodes SPT5-Like, a member of the nuclear SPT5 (Suppressor of Ty insertion 5) RNA polymerase (RNAP) elongation factor family that is characterized by the presence of a carboxy-terminal extension with more than 40 WG/GW motifs. Interacts with AGO4. Required for RNA-directed DNA methylation.
Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleusendosperm proliferation within the FG.
PAS domain-containing protein tyrosine kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: egg cell; CONTAINS InterPro DOMAIN/s: PAS fold (InterPro:IPR013767), Serine/threonine-protein kinase domain (InterPro:IPR002290), PAS (InterPro:IPR000014), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); BEST Arabidopsis thaliana protein match is: PAS domain-containing protein tyrosine kinase family protein (TAIR:AT3G06620.1); Has 125232 Blast hits to 123605 proteins in 4849 species: Archae - 220; Bacteria - 14873; Metazoa - 46551; Fungi - 11020; Plants - 33122; Viruses - 498; Other Eukaryotes - 18948 (source: NCBI BLink).
Encodes a putative transcription factor MEDEA (MEA) that negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is a Polycomb group gene that is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization
Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT1G63480.1); Has 999 Blast hits to 995 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 171; Fungi - 26; Plants - 768; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
transcriptional factor B3 family protein, contains Pfam profile PF02362: B3 DNA binding domain. Activated by AGAMOUS ina a cal-1, ap1-1 background. Expressed in stamen primordia, the placental region of developing carpels and the ovary.
Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence.
encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
bZIP transcription factor induced by salt stress and promoted salt tolerance. Localized to the cytoplasm and nucleus under control conditions and targeted preferentially to the nucleus under salt stress
Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity.
Encodes PNM1 (for PPR protein localized to the nucleus and mitochondria 1), a PPR protein that is dual localized to mitochondria and nuclei. Loss of PNM1 function in mitochondria, but not in nuclei, is lethal for the embryo. In mitochondria, it is associated with polysomes and may play a role in translation.
Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression.
Encodes OFP4, a member of the plant specific ovate family proteins. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. OFP4 interacts with KNAT7 to regulate secondary cell wall formation.
One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated.
Encodes SHA1 (shoot apical meristem arrest), a putative E3 ligase (a RING finger protein) required for post-embryonic SAM maintenance. The mutant sha1-1 shows a primary SAM-deficient phenotype at the adult stage.
Encodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation.
Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression.
Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response.
TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium.
Encodes an auxin-regulated transcriptional activator. Activates expression of IAA1 and IAA9 in the presence of auxin. Mutants affect blue light and gravitropic and auxin mediated growth responses. Together with AUX19, it is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin.
Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner.
Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses.
NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root.
Encodes a plant homolog of a SWIRM domain containing protein found in histone deacetylase complexes in mammals. Lesions in FLD result in hyperacetylation of histones in FLC chromatin, up-regulation of FLC expression and extremely delayed flowering. FLD plays a key role in regulating the reproductive competence of the shoot and results in different developmental phase transitions in Arabidopsis.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
Enodes a subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme. SIG1 is induced by red and blue light.
Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions.
Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway.
ovate family protein 11 (OFP11); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 16 (TAIR:AT2G32100.1); Has 297 Blast hits to 297 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 297; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
DNA GYRASE A (GYRA); FUNCTIONS IN: DNA topoisomerase activity, catalytic activity, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion, chloroplast, nucleoid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA gyrase, subunit A (InterPro:IPR005743), DNA topoisomerase, type IIA, subunit A/C-terminal (InterPro:IPR002205), DNA topoisomerase, type IIA, subunit A/ C-terminal, alpha-beta (InterPro:IPR013758), DNA topoisomerase, type IIA, subunit A, alpha-helical (InterPro:IPR013757), DNA topoisomerase, type IIA, central (InterPro:IPR013760), DNA gyrase/topoisomerase IV, subunit A, C-terminal beta-pinwheel (InterPro:IPR006691); BEST Arabidopsis thaliana protein match is: topoisomerase II (TAIR:AT3G23890.1); Has 22353 Blast hits to 21396 proteins in 3265 species: Archae - 84; Bacteria - 12907; Metazoa - 182; Fungi - 204; Plants - 111; Viruses - 99; Other Eukaryotes - 8766 (source: NCBI BLink).
Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5A) and expressed in vegetative and reproductive tissues.
Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two.
Encodes a zinc finger protein and is expressed at high levels in the shoot apex, including the apical meristem, developing leaves and the developing vascular system. expression induced three days post germination. T-DNA insertion mutant has a dominant phenotype in leaf initiation.
Encodes a novel plant-specific TFIIB-related protein that can interact with TBP2 and bind DNA. It can also form a homodimer and interact with the subunits of RNA polymerases. Mutant pollen fails to germinate.
B-box type zinc finger protein with CCT domain; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: B-box type zinc finger protein with CCT domain (TAIR:AT4G15250.1); Has 2815 Blast hits to 2182 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 2726; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes.
Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA.
Encodes a member of a plant-specific class of histone deacetylases. Controls the development of adaxial/abaxial leaf polarity. Its mRNA is widely expressed in stems, leaves, flowers and young siliques. Plant lines expressing RNAi constructs directed against this gene showed a marked reduction in agrobacterium-mediated root transformation.
TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex.
Encodes a protein with similarity to RAF MAP kinases. Based on loss of function phenotype, RAF11 appears to be involved in mediating ABA responses such as dormancy and environmental stress. Expressed in most plant tissues but excluded from root tips and young leaves.
Josephin family protein; CONTAINS InterPro DOMAIN/s: Machado-Joseph disease protein MJD (InterPro:IPR006155); BEST Arabidopsis thaliana protein match is: JOSEPHIN-like protein (TAIR:AT2G29640.1); Has 590 Blast hits to 584 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 441; Fungi - 14; Plants - 76; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
Encodes a transcriptional repressor that is homologous to the C-terminal region of mammalian GC binding factor. It regulates endoreduplication through control of CYC2A expression.
Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif.
Predicted AT-hook DNA-binding family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: Predicted AT-hook DNA-binding family protein (TAIR:AT4G22810.1); Has 6654 Blast hits to 4300 proteins in 274 species: Archae - 0; Bacteria - 187; Metazoa - 2435; Fungi - 660; Plants - 926; Viruses - 16; Other Eukaryotes - 2430 (source: NCBI BLink).
ovate family protein 14 (OFP14); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 13 (TAIR:AT5G04820.1); Has 451 Blast hits to 451 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 29; Plants - 394; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
This gene encodes the second largest, catalytic subunit of the nuclear DNA-dependent RNA polymerase IV (aka RNA polymerase D). The NRPD2 protein is found at nuclear foci that overlap or are adjacent to chromocentromeres but are not fully coincident with chromocentromeres. The loss of NRPD2 leads to the loss of cytosine methylation at pericentromeric 5S genes and AtSN1 retroelements but has no discernible effect on centromere repeat methylation. This suggests that Pol IV primarily affects facultative heterochromatin rather than constitutive heterochromatin.
Encodes an R2R3 myb transcription factor that is required for male gamete formation, specifically for entry of the generative cell into mitosis. Specifically expressed in the male germline.
Encodes a sigma-like transcription factor, Sigma 3 (SIG3 or SIGC). As a subunit of chloroplast RNA polymerase, SIG3 confers the ability to recognize promoter sequences on the core enzyme. SIG3 transcribes specifically the psbN gene in plastids.
Encodes a mitochondrial transcription termination factor (mTERF) family protein. The gene product is targeted to the chloroplast and mutants are affected in chloroplast development. Mutants, named as twirt1 (twr-1), display altered root meristem function resulting in short roots. Mutation also affects shoot meristem function.
ovate family protein 3 (OFP3); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 4 (TAIR:AT1G06920.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Encodes PLANT HOMOLOGOUS TO PARAFIBROMIN (PHP), a homolog of human Paf1 Complex (Paf1C) subunit Parafibromin. Human Parafibromin assists in mediating output from the Wnt signaling pathway, and dysfunction of the encoding gene HRPT2 conditions specific cancer-related disease phenotypes. PHP resides in a ~670-kDa protein complex in nuclear extracts, and physically interacts with other known Paf1C-related proteins in vivo. Loss of PHP specifically conditioned accelerated phase transition from vegetative growth to flowering and resulted in misregulation of a very limited subset of genes that included the flowering repressor FLOWERING LOCUS C (FLC).
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Encodes an type I protein arginine methyltransferase. PRMT4b can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY.
MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions.
MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects.
Encodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots. Mutants also have no ncm5U (5-carbamoylmethyluridine).
Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. Binds DPA and RBR1 proteins. Expressed throughout the cell cycle. Abundance increased by auxin through stabilization of the protein. Elevates CDK levels and activity, even under hormone-free conditions. Promotes cell division and shortens cell doubling time, inhibits cell growth. Transgenic plants overexpressing AtE2Fa contained an increased level of AtE2Fb transcripts that is paralleled by an increase in the amount of the AtE2Fb protein, suggesting that AtE2Fb expression might actually be up-regulated by the AtE2Fa transcription factor.
Zinc finger (CCCH-type) family protein; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: Zinc finger C-x8-C-x5-C-x3-H type family protein (TAIR:AT2G35430.1); Has 13421 Blast hits to 5509 proteins in 634 species: Archae - 13; Bacteria - 2784; Metazoa - 4906; Fungi - 574; Plants - 3348; Viruses - 263; Other Eukaryotes - 1533 (source: NCBI BLink).
ovate family protein 7 (OFP7); INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: shoot apex, embryo, hypocotyl, flower, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 8 (TAIR:AT5G19650.1); Has 500 Blast hits to 498 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 5; Plants - 493; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
Encodes Argonaute10, a member of the EIF2C (elongation initiation factor 2c)/ Argonaute class of proteins. Required to establish the central-peripheral organization of the embryo apex. Along with WUS and CLV genes, controls the relative organization of central zone and peripheral zone cells in meristems. Acts in embryonic provascular tissue potentiating WUSCHEL function during meristem development in the embryo. AGO10 specifically sequesters miR166/165 to regulate shoot apical meristem development.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1.
Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene.
Protein of unknown function, DUF547; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF547 (InterPro:IPR006869); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF547 (TAIR:AT1G16750.1); Has 738 Blast hits to 726 proteins in 118 species: Archae - 2; Bacteria - 127; Metazoa - 26; Fungi - 3; Plants - 527; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses.
Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3.
encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
Encodes a novel protein of unknown function with homologs in non-seed plants. Sequence analysis predicts membrane spanning domains and a putative protein-protein interaction domain. Semi-dominant mutations display defects in phenylpropanoid accumulation suggesting a role in phenylpropanoid metabolism. It has been shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At3g23590). Required for expression of some dark-upregulated genes.
Encodes BES1-INTERACTING MYC-LIKE 3 (BIM3), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings.
Encodes a chloroplast envelope-bound plant homeodomain (PHD) transcription factor with transmembrane domains that functions in multiple retrograde signal pathways. The proteolytic cleavage of PTM occurs in response to retrograde signals and amino-terminal PTM accumulates in the nucleus, where it activates ABI4 transcription in a PHD-dependent manner associated with histone modifications.
Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT3G24850.1); Has 196 Blast hits to 185 proteins in 22 species: Archae - 0; Bacteria - 7; Metazoa - 15; Fungi - 10; Plants - 139; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
Plant regulator RWP-RK family protein; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Plant regulator RWP-RK (InterPro:IPR003035); BEST Arabidopsis thaliana protein match is: NIN like protein 7 (TAIR:AT4G24020.1); Has 703 Blast hits to 646 proteins in 50 species: Archae - 0; Bacteria - 2; Metazoa - 50; Fungi - 0; Plants - 585; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).
Encodes a member of the MYB family of transcription factors. Involved in regulation of anthocyanin biosynthesis. Affects the expression of enzymes involved in later steps of anthocyanin biosynthesis.
SWI-SNF-related chromatin binding protein; BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G57580.1); Has 58 Blast hits to 53 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime.
Protein is similar to SWI2/SNF2 chromatin remodeling proteins. DDM1 is appears to act as a chromatin-remodeling ATPase involved in cytosine methylation in CG and non-CG contexts. Involved in gene silencing and maintenance of DNA methylation and histone methylation. Hypomethylation of many genomic regions occurs in ddm1 mutants, and can cause several phenotypic abnormalities, but some loci, such as BONSAI (At1g73177) can be hypermethylated in ddm1 mutants after several generations, leading to different phenotypes. DDM1 might be involved in establishing a heterochromain boundary. A line expressing an RNAi targeted against DDM1 shows some resistance to agrobacterium-mediated root transformation.
Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress.
Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.
Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves.
Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3).
Encodes a member of a recently identified plant transcription factor family that includes Teosinte branched 1, Cycloidea 1, and proliferating cell nuclear antigen (PCNA) factors, PCF1 and 2. Regulated by miR319. Involved in heterochronic regulation of leaf differentiation.
Encodes ICE2 (Inducer of CBF Expression 2), a transcription factor of the bHLH family that participates in the response to deep freezing through the cold acclimation-dependent pathway. Overexpression of ICE2 results in increased tolerance to deep freezing stress after cold acclimation.
FEZ (FEZ); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 94 (TAIR:AT5G39820.1); Has 2973 Blast hits to 2966 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 2971; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box–dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation.
Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.
BNQ3 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals. Required for appropriate regulation of flowering time.May also have a role in regulating light responses.
Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs.
Encodes a protein that is involved in mRNA processing and localized to cytoplasmic p-bodies. Double mutants with CCR4a show decreased sensitivity to high concentrations of sucrose. Involved in starch and sucrose metabolism.
Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS).
Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance.
Encodes a calmodulin-binding NAC protein (CBNAC). Contains calmodulin-binding domain in the C-terminus of the protein. Functions as a calmodulin-regulated transcriptional repressor.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower.
Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2.
Encodes PHERES2, a homolog of PHERES1. PHERES1 and PHERES2 are both target genes of the FIS Polycomb group complex but only PHERES1 is regulated by genomic imprinting, which is likely caused by the presence of repeat sequences in the proximity of the PHERES1 locus.
encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.
Encodes a phytochrome photoreceptor with a function similar to that of phyB that absorbs the red/far-red part of the light spectrum and is involved in light responses. It cannot compensate for phyB loss in Arabidopsis but can substitute for tobacco phyB in vivo.
Highly homologous to AKR2A. Involved in chloroplast biogenesis. Double mutants of AKR2A and AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes.
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box–mediated transcription together with AtSin3 and HDA19.
Encodes a nuclear targeted protein that plays a role in the CBF pathway -downstream of CBF translation. Mutants have impaired cold responses, reduced levels of cold induced RNA transcripts, are sensitive to osmotic stress. Required for expression of CBF-controlled cold-upregulated genes and some, but not all, other cold up-regulated genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes.
Encodes a protein with similarity to RAF MAP Kinase that is expressed in most plant tissues. Based on loss of function and gain of function phenotypes, RAF10 appears to be involved in ABA response.
CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state.
In conjunction with SPL11 and SPL2, SPL10 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL10 also controls lamina shape during vegetative development.
Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold.
Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR.
Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene.
Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation.
TATA-binding related factor (TRF) of subunit 20 of Mediator complex; FUNCTIONS IN: RNA polymerase II transcription mediator activity; INVOLVED IN: regulation of transcription from RNA polymerase II promoter; LOCATED IN: mediator complex; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit Med20 (InterPro:IPR013921); BEST Arabidopsis thaliana protein match is: TATA-binding related factor (TRF) of subunit 20 of Mediator complex (TAIR:AT4G09070.1); Has 80 Blast hits to 80 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture.
Encodes a basic helix-loop helix transcription factor involved in tapetal cell development. Loss of function mutations are male sterile. AMS binds to a region termed the E box of target gene promoters.
LIGHT SENSITIVE HYPOCOTYLS 5 (LSH5); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF640) (TAIR:AT1G07090.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24.
Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. AtE2Fc is regulated by a balance between gene expression and ubiquitin-proteasome proteolysis. AtE2Fc might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. E2Fc has been shown to interact with DPB in its nonphosphorylated form; when E2Fc is phosphorylated, the formation of the E2Fc/DPB heterodimer is lost.
Mutations confer hypersensitivity to glucose and sucrose and augments sensitivity to cytokinin, ethylene, ABA and auxin. Encodes a nuclear WD40 protein that is imported into the nucleus. Essential for plant innate immunity. Interacts with MOS4 and AtCDC5. It is also predicted to have two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase, and may affect the stability of AKIN10.
RSM1 is a member of a small sub-family of single MYB transcription factors. Analysis of overexpressin lines indicate its involvement during early morphogenesis.
Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation.
Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing.
Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus.
MED9; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29580.1); Has 67203 Blast hits to 25757 proteins in 1293 species: Archae - 12; Bacteria - 4374; Metazoa - 24340; Fungi - 7940; Plants - 5927; Viruses - 273; Other Eukaryotes - 24337 (source: NCBI BLink).
Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT2G45850.2); Has 861 Blast hits to 857 proteins in 59 species: Archae - 0; Bacteria - 6; Metazoa - 83; Fungi - 11; Plants - 756; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
E2F-like protein, an inhibitor of the endocycle, preserves the mitotic state of proliferating cells by suppressing transcription of genes that are required for cells to enter the DNA endoreduplication cycle.
encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family.
Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner.
Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes.
Encodes a NAC-domain transcription factor that is expressed in developing vessels and protoxylem. Along with other members of this family, VND1 appears to regulate the development of genes required for secondary cell wall biosynthesis.
Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV.
FPA is a gene that regulates flowering time in Arabidopsis via a pathway that is independent of daylength (the autonomous pathway). Mutations in FPA result in extremely delayed flowering. Double mutants with FCA have reduced fertility and single/double mutants have defects in siRNA mediated chromatin silencing.
Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes.
AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.
Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control.
Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower.
Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues.
Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings.
Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism.
Encodes a member of a novel family having similarity to DNA binding proteins containing basic-leucine zipper regions; scr is expressed in cortex/endodermal initial cells and in the endodermal cell lineage. Regulates the radial organization of the root. Is required cell-autonomously for distal specification of the quiescent center, which in turn regulates stem cell fate of immediately surrounding cells. SCR appears to be a direct target of SHR.
vascular plant one zinc finger protein 2 (VOZ2); BEST Arabidopsis thaliana protein match is: vascular plant one zinc finger protein (TAIR:AT1G28520.2); Has 87 Blast hits to 82 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF6 to control stamen elongation and flower maturation. Expression of ARF8 is controlled by miR167.
Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering.
Encodes PHYTOCHROME RAPIDLY REGULATED1 (PAR1), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR2 (At3g58850). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510).
Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2.
Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses.
Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus.
Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development.
Encodes CIB5 (cryptochrome-interacting basic-helix-loop-helix). Related to CIB1 (AT4G34530). CIB5 interacts with CRY2 and forms heterodimer with CIB1 in vitro. Regulates flowering time redundantly with CIB1.
Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants.
Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.
Roxy1 encodes a glutaredoxin belonging to a subgroup specific to higher plants. It is required for proper petal initiation and organogenesis. It is likely to function in the temporal and spatial expression regulation of AGAMOUS in the first and second whorl. It's function is dependent on the Cysteine 49 residue and its nuclear localization. ROXY1 interacts in vitro and in vivo with members of the TGA family of transcription factors (e.g. TGA2, TGA3, TGA7 and PAN).
Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664).
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
encodes a protein containing Dof zinc finger motifs. expression is limited to vascular system of the mother plant. recessive mutation is inherited as maternal-effect and expression is not detected in the embryo. mutants are defective in seed germination. mutants are more dependent on light and cold treatment and less sensitive to gibberellin during seed germination.
Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY.
encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family.
Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress.
Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction.
HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower.
Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. Overexpression of the gene results in delayed flowering. Is likely to act redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene.
RPT2a encodes the 26S proteasome subunit. It is required for root meristem maintenance, and regulates gametogenesis. RPT2a is also shown to regulate gene silencing via DNA methylation.
Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA
Negative regulator of systemic acquired resistance (SAR), repressor of pathogenesis-related PR gene expression which is removed by NPR1 upon induction of SAR. Encodes leucine-rich nuclear protein. Conserved in plants, with putative orthologs found in several plant species. Many NPR1-dependent PR gene are specifically derepressed in the sni1 mutant. The structural similarity of SNI1 to Armadillo repeat proteins implies that SNI1 may form a scaffold for interaction with proteins that modulate transcription. Histone modification may be involved in SNI1-mediated repression of PR genes.
Protein of unknown function (DUF1664); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1664) (TAIR:AT2G02730.2); Has 199 Blast hits to 190 proteins in 29 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 2; Plants - 161; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation.
Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence.
Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains.
Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. Involved in polar nuclei fusion during proliferation of endosperm nuclei.
Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes.
Encodes SU(var)3-9 homologue 5 (SUVH5). SUVH5 has histone methyltransferase (MTase) activity in vitro and contributes to the maintenance of H3 mK9 (methylation of histone H3 at Lys-9) and CMT3-mediated non-CG methylation in vivo. This is a member of a subfamily of SET proteins that shares a conserved SRA domain.
Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment.
encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT3G24850.1); Has 119 Blast hits to 119 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 119; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
basic leucine zipper transcription factor (BZIP67), identical to basic leucine zipper transcription factor GI:18656053 from (Arabidopsis thaliana); identical to cDNA basic leucine zipper transcription factor (atbzip67 gene) GI:18656052. Located in the nucleus and expressed during seed maturation in the cotyledons.
Similar to ARR response regulator proteins that function in two-component signal transduction but lacking a conserved D-D-K motif in the receiver domain
Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene. Auxin and ethylene responsiveness of PAP1 transcription is lost in myb12 mutants.
Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation.
LITTLE ZIPPER 2 (ZPR2); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT2G45450.1); Has 63 Blast hits to 63 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering.
An unique homologue of STOP1 (AT1G34370) in Arabidopsis genome. Transformation to the stop1-mutant activated several genes that are regulated by STOP1, and conferred proton sensitive phenotype.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT4G25320.1); Has 1243 Blast hits to 1178 proteins in 110 species: Archae - 0; Bacteria - 11; Metazoa - 305; Fungi - 62; Plants - 787; Viruses - 15; Other Eukaryotes - 63 (source: NCBI BLink).
Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL65 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth.
Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway.
Encodes BELAYA SMERT (BSM), a plastid-localized protein homologous to mitochondrial transcription termination factors (mTERF) found in animal. Mutant bsm cells are albino, are compromised in growth, and suffer defects in global plastidic gene expression.
Encodes a member of the MYB family of transcription factors. Involved in regulation of anthocyanin biosynthesis. Affects the expression of enzymes involved in later steps of anthocyanin biosynthesis
Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator.
Encodes a bHLH transcription factor strongly expressed in the tapetum from late anther stage 5 to early stage 6, and at a lower level in meiocytes. dyt1 mutant exhibits abnormal anther morphology beginning at anther stage 4. DYT1 acts downstream of SPL/NZZ and EMS1/EXS , and is required for normal expression of AMS, MS1 and other tapetum preferential genes.
encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid.
Encodes a MIXTA-like MYB gene NOECK (NOK). Loss of function mutations show an increased number of branchpoints in leaf trichomes suggesting a role in negative regulation of trichome branching.
Encodes a novel Cys-rich protein with a B-box like domain that acts as a negative regulator of meristem cell accumulation in inflorescence and floral meristems as loss-of-function ult1 mutations cause inflorescence meristem enlargement, the production of extra flowers and floral organs, and a decrease in floral meristem determinacy. Acts opposite to CLF which represses AG, but preventing deposition of CLF repressive methylation marks.
Encodes HDA14, a member of the histone deacetylase family proteins that can deacetylate a-tubulin, associates with a/b-tubulin and is retained on GTP/taxol-stabilized microtubules, at least in part, by direct association with the PP2A-A2 subunit. The association of a histone deacetylase with PP2A suggests a direct link between protein phosphorylation and acetylation.
Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated.
Encodes a member of the MYB family of transcriptional regulators. MYB5 act as a negative regulator of trichome branching and play a role in the correct formation of the seed coat and possibly the formation the underlying endosperm layers. Loss of function mutations have defects in seed coat mucilage and columella cells as well as trichome defects (smaller and reduced number of branches).
Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression.
Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2.
Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3.
Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B.
In conjunction with SPL10 and SPL2, SPL11 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase.
A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia
Encodes RPT5a (Regulatory Particle 5a), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype.
member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay.
Encodes WHY2, a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus. WHY2 is a member of the Whirly family proteins present mainly in the plant kingdom performing various activities related to DNA metabolism. Crystal structure of Solanum tuberosum WHY2, a close homolog of Arabidopsis WHY2, reveal that Whirly proteins bind to single strand DNA to promote accurate repair of DNA double-strand breaks over an error-prone repair pathway.
Transcriptional activator of genes required for both embryo maturation and cellular differentiation. Sequence is similar to HAP3 subunit of the CCAAT-box binding factor. HAP3 subunit is divided into three domains: an amino-terminal A domain, a central B domain, and a carboxyl-terminal C domain. LEC1 shared high similarity with other HAP3 homologs only in central, B domain. LEC1 is required for the specification of cotyledon identity and the completion of embryo maturation. It was sufficient to induce embryogenic programs in vegetative cells, suggesting that LEC1 is a major embryonic regulator that mediates the switch between embryo and vegetative development. Mutants are desiccation intolerant, have trichomes on cotyledons and exhibit precocious meristem activation. Levels of the ABI3 and FUS3 transcripts were significantly reduced in developing siliques of the lec1-1 mutants, indicating that LEC1 down-regulates FUS3 and ABI3.When LEC1 is overexpressed from an inducible promoter, the expression of numerous genes involved in fatty acid biosynthesis is increased suggesting a role in positive regulation of FA biosynthesis.
A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation.
Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering.
Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1.
Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors.
Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development and defense gene transcription during plant immune responses.
Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl.
Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction.
encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain and is phosphorylated in planta. There are 7 members in this subfamily.
Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Involved in trimethylating histone H3-lysine 4. Involved in the formation, placement, and identity of flower organs. Role in regulation of homeotic genes. Functions as a receptor of phosphatidylinositol 5-phosphate. Localizes to cytoplasm, plasma membrane and nuclei, shifting to nuclei in the presence of PI5P.
A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956), A.T hook-like (InterPro:IPR020478); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT1G63470.1); Has 860 Blast hits to 856 proteins in 70 species: Archae - 0; Bacteria - 8; Metazoa - 47; Fungi - 33; Plants - 756; Viruses - 1; Other Eukaryotes - 15 (source: NCBI BLink).
Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
PFS2 encodes a homeodomain gene that is a member of the WUS clade of transcription factors. It delays differentiation and maturation of primordia and regulates ovule patterning. The pfs2 mutant exhibits developmental defects in the maternal integuments and gametophyte, specifically, the boundary between the chalaza and the nucellus shifted towards the distal end of pfs2 ovule primordia. In addition, leaves displayed curling and petals were wavy and crenulated. Overexpression of PFS2 affects floral organ and leaf development. Single- and double-mutant analyses reveal that PFS2 activity represses AGAMOUS expression in young floral primordia. Also involved in regulation of response to low temperature.
Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. When the target site is mutated , expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity.
Arabidopsis thaliana WOX8 protein. Contains similarity to homeodomain transcription factor. Positively regulates early embryonic growth. Together with CLE8 it forms a signaling module that promotes seed growth and overall seed size.
Similar to prokaryote sensory transduction proteins. Contains a histidine kinase and a response regulator domain. Homodimer. Membrane component. Binds ethylene. Mutations affect ethylene binding and metabolism of other plant hormones such as auxin, cytokinins, ABA and gibberellic acid. Ethylene receptor. Has histidine kinase activity. Is regulated by RTE1. Mutations in ETR1 block ethylene stimulation of flavonol synthesis.
Encodes a zinc finger-homeodomain transcription factor ZHD5. Nuclear import and DNA binding of the ZHD5 transcription factor is modulated by a competitive peptide inhibitor MIF1 (AT1G74660).
Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes.
predicted to encode a protein with an N-terminal PHD domain and two RING domains surrounding an SRA domain. Attempts to isolate ORTH4/VIM4 cDNA through RT-PCR were unsuccessful and analysis of the expression of this gene is difficult since it shares 99% nucleotide identity with ORTH5/VIM2.
Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key role in regulating trichome development by integrating GA and cytokinin signaling.
Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members.
Encodes a WD-40 repeat protein similar to yeast MSI1. The predicted protein has a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
LIGHT SENSITIVE HYPOCOTYLS 3 (LSH3); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF640) (TAIR:AT1G07090.1); Has 309 Blast hits to 309 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 297; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Floral homeotic gene encoding a MADS domain transcription factor. Specifies floral meristem and carpel and stamen identity. Binds CArG box sequences. It is the only C function gene. It interacts genetically with the other homeotic genes to specify the floral organs.
Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2.
Encodes a protein that is involved in mRNA processing and localized to cytoplasmic p-bodies. Double mutants with CCR4b show decreased sensitivity to high concentrations of sucrose. Involved in starch and sucrose metabolism.
LSD1 monitors a superoxide-dependent signal and negatively regulates a plant cell death pathway. contains zinc-finger motifs. LSD1 negatively regulates a basal defense pathway that can act upstream or independently of both NIM1/NPR1 function and SA accumulation following avirulent or virulent pathogen challenge
Predicted AT-hook DNA-binding family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: Predicted AT-hook DNA-binding family protein (TAIR:AT2G35270.1); Has 956 Blast hits to 951 proteins in 109 species: Archae - 0; Bacteria - 110; Metazoa - 54; Fungi - 9; Plants - 764; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation.
JKD is a nuclear-localized putative transcription factor with three zinc finger domains. jkd mutants show a number of root patterning defects including ectopic periclinal divisions in the cortex, increased cell numbers in the cortical and epidermal layers, a disrupted QC marker expression pattern, and disorganized QC and columella cells. jkd mutants also have a reduced number of meristematic cells in their roots. JKD can interact with the SCR and SHR proteins implicated in root patterning, as well as another zinc finger transcription factor, MAGPIE. All of these interactions require the first zinc finger in JKD according to a Y2H assay. There are also transcriptional interactions among these proteins. The initiation of JKD transcription does not appear to depend on SCR and SHR, but later expression in the post-embryonic QC cells and ground tissue initials is reduced in scr and shr mutants. JKD also appears to be required for SCR transcription beginning in the embryo. There is also some evidence that JKD plays a role in promoting the movement of SHR into the nucleus, particularly in QC cells, but this may be indirect.
Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It binds DNA, may directly regulate AP1, and is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR.
ovate family protein 12 (OFP12); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 16 (TAIR:AT2G32100.1); Has 358 Blast hits to 358 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 358; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP.
Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. It fulfills its role through recruitment of the Arabidopsis Retinoblastoma homologue, RETINOBLASTOMA-RELATED (RBR). Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. Its transcript levels change after inducing MUTE expression in a mute background.
Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway.
Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element.
Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14.
encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. This gene is involved in wax biosynthesis. Over-expression of the gene results in glossy leaf phenotype and increased drought tolerance. Two closely related genes, AT5G25390 and AT5G11190 have similar phenotypes when over-expressed. Strong expression levels in flowers. Binds to the promoter of LACS2.
HIT zinc finger ;PAPA-1-like conserved region; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT3G06660.1); Has 3160 Blast hits to 2461 proteins in 330 species: Archae - 7; Bacteria - 184; Metazoa - 1235; Fungi - 390; Plants - 202; Viruses - 26; Other Eukaryotes - 1116 (source: NCBI BLink).
encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature.
The pale cress (pac) mutant affects chloroplast and leaf development; mutants are ABA-deficient and accumulate lower levels of carotenoids and chlorophyll compared to wild type. PAC is probably involved in chloroplast mRNA maturation. Three alternative transcripts of this gene exist.
Encodes a nuclear-localized transcription activator that is a member of the R2R3 factor gene family. MYB82 and GL1 can form homodimers and heterodimers at R2R3-MYB domains. At least one of the two introns in MYB82 is essential to the protein?s trichome developmental function.
Member of the trihelix DNA binding protein family. Nuclear localized. Involved in repressing seed maturation genes during seed germination and seedling development.
encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression.
LIGHT SENSITIVE HYPOCOTYLS 6 (LSH6); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF640) (TAIR:AT5G58500.1); Has 311 Blast hits to 311 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 297; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes XPB2, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies.
Pol mutations are recessive, partial suppressors of meristem defects in strong clv1 and clv3 mutants, and nearly complete suppressors of weak clv1 mutants. Single mutants appear normal. Acts downstream of the CLV signaling pathway in meristem development and is required together with PLL1 for stem-cell maintenance through the regulation of WUS.
Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly.
Related to TOR proteins from yeast and mammals, regulators of cell growth in response to nutrient availability. TOR proteins belong to the family of phosphatidylinositol 3-kinase and are targets of the antiproliferative drug rapamycin. AtTOR binds the yeast FKBP12 protein in the presence of Rapamycin, is involved in embryogenesis and is expressed in embryos, endosperm and meristems.
Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. Mutants are defective in cold-regulated gene expression. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance.
Encodes a TFIIB-related protein expressed in the reproductive organs and seeds. Loss-of-function specifically affects the development of the syncytial endosperm. It is not required for RNA polymerase IV or V activities.
ovate family protein 18 (OFP18); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 15 (TAIR:AT2G36050.1); Has 432 Blast hits to 323 proteins in 54 species: Archae - 0; Bacteria - 2; Metazoa - 90; Fungi - 44; Plants - 215; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink).
Predicted AT-hook DNA-binding family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: Predicted AT-hook DNA-binding family protein (TAIR:AT1G14490.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence.
Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression.
Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size.
A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS.
Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder.
Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response.
Encodes a subunit of RNA polymerase IV (aka RNA polymerase D). NRPD2b is closely related to NRPD2a, but has lower levels of transcription and does not affect endogenous siRNA when mutated.
Encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.
ovate family protein 15 (OFP15); LOCATED IN: chloroplast; EXPRESSED IN: sepal, carpel, stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 18 (TAIR:AT3G52540.1); Has 245 Blast hits to 245 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 244; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
ovate family protein 2 (OFP2); INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 4 (TAIR:AT1G06920.1); Has 501 Blast hits to 493 proteins in 50 species: Archae - 0; Bacteria - 2; Metazoa - 28; Fungi - 6; Plants - 431; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
sequence-specific DNA binding transcription factors; BEST Arabidopsis thaliana protein match is: Homeodomain-like superfamily protein (TAIR:AT2G33550.1); Has 462 Blast hits to 461 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 2; Plants - 436; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose.
The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin.
The GSA41 human homolog is expressed in nuclei and binds NuMA, a component of the nuclear matrix in interphase nuclei. It negatively regulates flowering by controlling the H4 acetylation levels in the FLC and FT chromatin.
sequence-specific DNA binding transcription factors;transcription regulators; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18969.1); Has 115 Blast hits to 115 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.12). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. Involved in oxygen sensing.
Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response.
Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA.
Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo.
Glabra 2, a homeodomain protein affects epidermal cell identity including trichomes, root hairs, and seed coat. It also down-regulates seed oil content. Expressed in atrichoblasts and required to suppress root hair development. Also expressed abundantly during early seed development. Directly regulated by WER.
Encodes a protein that interacts with the Polycomb-group (Pc-G) histone methyltransferase CLF (CURLY LEAF). It colocalizes with CLF to the nucleus and represses a subset of Pc-G target genes. The pleiotropic developmental mutant phenotype suggests that BLI prevents premature differentiation.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G31720.1); Has 125 Blast hits to 125 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a protein that contains an SH2 domain. It can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is predicted to act as a transcription factor.
Encodes a putative mitochondrial transcription termination factor whose mutation results in plants that exhibit altered chloroplast morphology and plant growth, and reduced pigmentation of cotyledons, leaves, stems and sepals.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3.
Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family. ARR22 is more similar to the receiver domains of hybrid kinases than other response regulators. It acts as a phosphohistidine phosphatase when tested with phospho-AHP5 in vitro suggesting that it might be involved in a two-component phosphorelay. Expression of ARR22 transcripts appears to be localized to the chalaza and to be induced by wounding. Ectopic expression of ARR in other parts of the plant leads to reduced cytokinin-related responses and impaired root, shoot, and flower development. Overexpression of wild-type ARR22 in an arr22 mutant background causes variable defects in plant growth and fertility. But, in the same ar22 background, over-expression of versions of ARR22 that should act as dominant-negative or constitutively active proteins, based on mutations to the conserved Asp residue, do not show any phenotypic abnormalities, raising the possibility that these may not act as canonical response regulators.
Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.
UV damage and heat induce a common stress response in plants that leads to tissue death and reduced chloroplast function. The UVH6 product is suggested to be a negative regulator of this response.
BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development.
Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Interacts with BSH, AtSWI3A, SWI3C and FCA. Expressed ubiquitously.
CHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates.
homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem.
Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts.
Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.
Encodes a putative transcription factor (MYB26). Mutants produces fertile pollen but plants are sterile because anthers do not dehisce. The cellulosic secondary wall thickenings are not formed in the endothecium as they are in non-mutant plants.
Chromatin Assembly Factor-1 (CAF-1) p150 subunit. Mutants have reduced heterochromatin content. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis.
Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule.
encodes a protein with similarities to subunits of the Mediator complex, required for RNA polymerase II recruitment at target promoters in response to specific activators. Lines carrying loss of function mutations in the gene have reduced cell numbers in aerial organs. On the other hand, lines overexpressing the gene have increased number of small cells in clusters, suggesting cell division is more unsynchronized in the overexpressors.Required for expression of CBF-controlled cold-responsive genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes.
Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity.
ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation.
Encodes a MADS-box gene AGL105 (AGAMOUS-LIKE 105). Note that previous reports (Plant Cell 2003,15:1538; PNAS 2003, 100:13407) have incorrectly named AT5G37420 as AGL105. Current nomenclature is based on Plant Cell 2003, 15:1538 where the GenBank accession number given for AGL105 is AY141227 (Supplemental Table 3), which corresponds to AT5G37415.
Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6
Encodes SND1, a NAC Domain transcription factor involved in secondary wall biosynthesis in fibers. Expressed specifically in interfascicular fibers and xylary fibers in stems. Expressed in the procambium of stem inflorescences and root. May act as a negative regulator of secondary wall thickening in xylary fibers. Acts redundantly with NST1 to control development of secondary walls in siliques.
BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.
Encodes TRICHOMELESS1 (TCL1), a single-repeat MYB-type transcription factor that negatively regulates trichome formation by suppressing GL1 (GLABRA1). In a tandem repeat with AT2g30424 and AT2g30420.
Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (LEAFY PETIOLE). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. Acts as a positive regulator of gibberellic acid-induced germination.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).
Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC).
Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
Encodes HTA3, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10–20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin.
Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing.
Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover.
Domain of unknown function (DUF313) ; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G27410.1); Has 122 Blast hits to 122 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 122; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes JASON. jason mutant produces diploid male gametes leading to triploid progeny. Diploid gametes in the jason mutant are generated by a defect in male meiosis II.
bromodomain and extraterminal domain protein 10 (BET10); CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: bromodomain and extraterminal domain protein 9 (TAIR:AT5G14270.2); Has 12383 Blast hits to 9735 proteins in 571 species: Archae - 25; Bacteria - 644; Metazoa - 6126; Fungi - 1754; Plants - 803; Viruses - 19; Other Eukaryotes - 3012 (source: NCBI BLink).
In a tandem repeat with AT2g30432 (TCL1) and AT2g30420 (ETC2), it encodes a single-repeat R3 MYB transcription factor that is involved in the negative regulation of trichome formation.
Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization.
member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA.
Predicted AT-hook DNA-binding family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: Predicted AT-hook DNA-binding family protein (TAIR:AT5G49700.1); Has 747 Blast hits to 743 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 747; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
B-box type zinc finger protein with CCT domain; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: B-box type zinc finger protein with CCT domain (TAIR:AT1G73870.1); Has 3177 Blast hits to 2366 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3069; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
member of WRKY Transcription Factor; Group III. Function as activator of SA-dependent defense genes and a repressor of JA-regulated genes. WRKY70-controlled suppression of JA-signaling is partly executed by NPR1.
AT-hook motif nuclear-localized protein 1 (AHL1); FUNCTIONS IN: DNA binding; LOCATED IN: mitochondrion, nucleolus, nucleus, cytoplasm; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT4G22770.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants.
LIGHT SENSITIVE HYPOCOTYLS 10 (LSH10); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF640) (TAIR:AT1G07090.1); Has 309 Blast hits to 309 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 297; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2.
LIGHT SENSITIVE HYPOCOTYLS 8 (LSH8); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF640) (TAIR:AT1G78815.1); Has 310 Blast hits to 310 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 296; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR5 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation.
Encodes a homolog of the animal DP protein. DP, in animals, forms a heterodimer with E2F and plays a central role in G1/S transition in the cell division cycle. DPB has been shown to interact with non phosphorylated E2Fc; when E2Fc is phosphorylated, the formation of the E2Fc/DPB heterodimer is lost.
MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis.
Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end–processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC.
Encodes a transcriptional activator that is involved in pollen development. ARID1 is expressed in nuclear bodies of microspore, vegetative and generative cells, and binds to and activates DUO during microgametogenesis.
encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal.
Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants.
encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family.
This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation.
Encodes a putative zinc finger transcription factor that is necessary for proper lateral organ shape and is sufficient to induce the proliferation of lateral organ tissue. Together with NUB, it is involved in stamen and carpel development.
AGL80 is a member of the MADS box family of genes. AGL80 functions as a transcription factor within the central cell gene regulatory network and controls the expression of downstream genes required for central cell development and function.
NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression.
Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family . It appears to be expressed in floral buds, mature flowers, and pollen. But, unlike the related ARR22 protein, it does not appear to be expressed at the seed:funiculus junction.
Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins that acts as a novel upstream regulator of root hair formation during Pi starvation. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation.
AGAMOUS [AG]-like MADS box protein (AGL5) involved in fruit development (valve margin and dehiscence zone differentiation). A putative direct target of AG. SHP2 has been shown to be a downstream gene of the complex formed by AG and SEP proteins (SEP4 alone does not form a functional complex with AG).
MED19A; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19480.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner.
Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. Its transcription is induced by dehydration stress and ABA treatment. Negative regulator of blue light–mediated photomorphogenic growth and blue and far-red-light–regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression.
Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development.
Encodes a transcription repressor that mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two-component phosphorelay.
Encodes POLAR, a protein associated with cellular asymmetry of meristemoids. Its transcript levels change after inducing MUTE expression in a mute background.
A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate.
Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.
Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation.
Encodes NERD (Needed for RDR2-independent DNA methylation), a plant-specific GW repeat- and PHD finger-containing protein involved in siRNA-dependent DNA methylation.
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes a BEL1-like homeobox gene that functions together with PNY in meristem maintenance by regulating the allocation process during vegetative and reproductive development. Both gene products are required for the competence of the SAM to respond properly to floral inductive signals.
Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT5G24050.1); Has 134 Blast hits to 134 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 130; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
Encodes SUF4 (SUPPRESSOR of FRI 4), a putative zinc-finger-containing transcription factor that is required for delayed flowering in winter-annual Arabidopsis. suf4 mutations strongly suppress the late-flowering phenotype of FRI (FRIGIDA) mutants. suf4 mutants also show reduced H3K4 trimethylation at FLC (FLOWERING LOCUS C), a floral inhibitor. SUF4 may act to specifically recruit a putative histone H3 methyltransferase EFS (EARLY FLOWERING IN SHORT DAYS) and the PAF1-like complex to the FLC locus.
Encodes a transcriptional factor TFIIIA required for transcription of 5S rRNA gene. 5S rRNA is the smallest constituent of the ribosome. Work on one of the gene models AT1G72050.2 showed that it encodes a protein with nine Cys(2)-His(2)-type zinc fingers, a characteristic feature of TFIIIA proteins. AT1G72050.2 also contains a 23 amino acid spacer between fingers 1 and 2, a 66 amino acid spacer between fingers 4 and 5, and a 50 amino acid non-finger C-terminal tail. in vitro assay demonstrated that AT1g72050.2 binds to 5S rDNA and efficiently stimulates the transcription of 5S rRNA. AT1g72050.2 also binds to 5S rRNA in vitro. AT1g72050.2 is located at several nuclear foci including the nucleolus and is absent from the cytoplasm.
Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background.
Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB1 and the E. coli RNA polymerase beta prime subunit. Required for normal RNA-directed DNA methylation at non-CG methylation sites and transgene silencing.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
Encodes a a C2H2/C2HC zinc finger transcription factor specifically expressed in the transmitting tract and involved in transmitting tract development and pollen tube growth.
Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Transcription level and mutant phenotype are weaker than its homolog BRC1 (At3G18550).
Encodes a transcription factor involved in shoot apical meristem formation and auxin-mediated lateral root formation. The gene is thought not to be involved in stress responses (NaCl, auxins, ethylene). <i>Cuc</i> mutant was first recognized at the heart stage, where embryos lacking two distinct bulges of cotyledonary primordia were observed.
Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes.
Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes.
Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
Encodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering.
Zinc finger C-x8-C-x5-C-x3-H type family protein; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: Zinc finger C-x8-C-x5-C-x3-H type family protein (TAIR:AT1G66810.1); Has 1124 Blast hits to 1011 proteins in 226 species: Archae - 0; Bacteria - 0; Metazoa - 463; Fungi - 91; Plants - 303; Viruses - 0; Other Eukaryotes - 267 (source: NCBI BLink).
encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones.
Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability.
Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT5G38500.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation.
Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation.
Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves.
Leucine zipper transcription factor that binds to the abscisic acid (ABA)–responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G18810.1); Has 146 Blast hits to 146 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 146; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase.
Encodes a homeodomain leucine zipper class I (HD-Zip I) meristem identity regulator that acts together with LFY to induce CAL expression. It binds to the CAL promoter proximal CAATNATTG element. LMI1 acts primarily downstream of LFY in meristem identity regulation. The interaction between LFY, LMI1 and CAL resembles a feed-forward loop transcriptional network motif. The gene also had additional LFY-independent roles in leaf morphogenesis and bract formation.
Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1.
Encodes a protein that is similar to VIM1 but is not involved in cytosine methylation. This protein has an N-terminal PHD domain and two RING domains surrounding an SRA domain. ORTH5/VIM2 has E3 ubiquitin ligase activity in vitro.
NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root.
bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering.Expressed in the shoot apex in floral anlagen, then declines in floral primordia.
Sporophytic factor controlling anther and pollen development. Mutants fail to make functional pollen;pollen degeneration occurs after microspore release and the tapetum also appears abnormally vacuolated. Similar to PHD-finger motif transcription factors.
Encodes a negative regulator of seed development in the absence of pollination. In the ovule, the FIS2 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization.
Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.2f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated.
Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.
Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner.
Encodes EDM2 (enhanced downy mildew 2). The predicted protein bears typical features of transcriptional regulators. EDM2 contains two putative bipartite nuclear localization signals (NLS) two zinc-finger-like motifs, a Proline-rich region and a large aspartic acid-rich region. Both zinc-finger-like stretches resemble the PHD (plant homeodomain) finger motif. Mutations in EDM2 comprise RPP7 mediated resistance against Hyaloperonospora parasitica isolate Hiks1 (HpHiks1). EDM2 may function as a direct or indirect regulator of RPP7 expression.
Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.
encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering time loci FLC and FWA. Located in nucleus. Negatively regulates root elongation. Involved in repression of LRP1 via histone deacetylation.
Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia.
Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants.
Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha.
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY.
Similar to hinge-domain region of structural maintenance of chromosomes (SMC)proteins.Putative chromosome architecture protein that can potentialy link nucleic acids in facilitating an RNA1-mediated epigenetic modification involving secondary siRNA and spreading of DNA methylation.
Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress–inducible genes.
A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems.
Encodes a putative transcriptional factor. Shows transcriptional activator activity in yeast. Involved in response to abscisic acid, salt and osmotic stress.
Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002,7(7):301.
Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis.
Encodes a member of the ARF family of transcription factors which mediate auxin responses. ARF4 appears to have redundant function with ETT(ARF3) in specifying abaxial cell identity.
Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510.
Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3).
Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
encodes a MADS-box containing protein likely to be a transcription factor that is expressed in endosperm and developing gametophytes. The protein sequence is most similar to that of AGL15, which is expressed in developing embryos.
Encodes ACTIN-RELATED PROTEIN6 (ARP6), a putative component of a chromatin-remodeling complex. Required for both histone acetylation and methylation of the FLC chromatin in Arabidopsis. Along with PIE1 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). Incorporation of this variant histone into chromatin mediates the ambient temperature response. Located at specific regions of the nuclear periphery. Expression throughout plants shown by in-situ and immunolocalization methods. Mutants show defects in fertility, leaf, flower and inflorescence development and shorter flowering times. ARP6 also is involved in globally controlling developmental responses to ambient temperature through incorporation of variant histone H2A.Z into chromatin.
ovate family protein 8 (OFP8); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 7 (TAIR:AT2G18500.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Encodes a basic helix-loop-helix (bHLH) transcription factor that is necessary and sufficient for the asymmetric divisions that establish the stomatal lineage in Arabidopsis thaliana. Expression of SPCH in young epidermal cells allows these cells to make asymmetric divisions. SPCH is a substrate of a kinase MPK3 and MPK6. Its transcript levels change after inducing MUTE expression in a mute background.
Involved in light-dependent cold tolerance and encodes an enolase. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.9). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1 and RAP2.10.
encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.
Encodes the Arabidopsis INO80 ortholog of the SWI/SNF ATPase family. Functions as a positive regulator of DNA homologous recombination (HR). In INO80 mutants, the HR frequency is reduced to 15% of that in the wild-type. Mutation in INO80 does not affect sensitivity to genotoxic agents and efficiency of T-DNA integration. INO80 was also shown to regulate a subset of the Arabidopsis transcriptome.
encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily.
Domain of unknown function (DUF313) ; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G32645.1); Has 140 Blast hits to 140 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family (RAP2.11). The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT-hook motif nuclear-localized protein 1 (TAIR:AT4G12080.1); Has 969 Blast hits to 965 proteins in 147 species: Archae - 0; Bacteria - 205; Metazoa - 5; Fungi - 3; Plants - 754; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine).
Encodes WRKY transcription factor 2, a zinc-finger protein. In wrky2 mutants, egg cells polarize normally but zygotes fail to reestablish polar organelle positioning from a transient symmetric state, resulting in equal cell division and distorted embryo development.
Encodes MADS-box containing FLC paralog. Five splice variants have been identified but not characterized with respect to expression patterns and/or differing function. Overexpression of the gene in the Landsberg ecotype leads to a delay in flowering, transcript levels of MAF4 are reduced after a 6 week vernalization.
Encodes one of the two RPT2 (26S proteasome subunit RPT2) paralogs: RPT2a (At4g29040) and RPT2b (At2g20140). RPT2b can not complement the rpt2a mutant phenotype. rpt2a rpt2b double mutants are embryo lethal.
Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor.
Transcription factor homologous to ABI5. Regulates AtEm1 expression by binding directly at the AtEm1 promoter. Located in the nucleus and expressed during seed maturation in the cotyledons and later in the whole embryo.
Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed.
AGL62 encodes a Type I MADS domain protein that likely functions as a transcription factor. It is expressed AGL62 is expressed exclusively in the endosperm. AGL62 supresses suppresses cellularization during the syncytial phase of endosperm development.
Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein.
Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP61. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells.
Encodes a putative zinc finger protein (C2H2 family, type IIIA, subclass A1d) that has a WIP domain. Seedlings with mutations in DOT5 have a misaligned venation defect in their leaves and cotyledons. Additional developmental abnormalities, such as elongated petioles and aberrant phyllotaxy suggest that DOT5 is required for normal shoot and root development.
NAC-domain protein. Involved in root cap development. Involved in a regulatory feedback loop with FEZ. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions.
NAC transcription factor NST2. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls. NST2 promoter was particularly strong in anther tissue.
Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.
Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development.
CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves.
Encodes a putative c-myb-like transcription factor. Member of a class of domain proteins containing structural features of the vertebrate c-Myb proto-oncoprotein, including the presence of three Myb motifs (R1,R2,R3).
Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA.
WRINKLED1 encodes transcription factor of the AP2/ERWEBP class. Protein has two plant-specific (AP2/EREB) DNA-binding domains and is involved in the control of storage compound biosynthesis in Arabidopsis. Mutants have wrinkled seed phenotype, due to a defect in the incorporation of sucrose and glucose into triacylglycerols. Transgenic sGsL plants (21-day-old) grown on 6% sucrose for 24 hours had 2-fold increase in levels of expressions (sGsL line carries a single copy of T-DNA containing the Spomin::GUS-Spomin::LUC dual reporter genes in the upper arm of chromosome 5 of ecotype Col-0. The sporamin .minimal. promoter directs sugar-inducible expression of the LUC and GUS reporters in leaves). Regulation by LEC2 promotes fatty acid accumulation during seed maturation.
Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.
Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches.
Encodes a member of the Arabidopsis response regulator (ARR) family, most closely related to ARR15. A two-component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin.
Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets.
Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis.
Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant.
Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast.
Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling.
This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation.
CCT motif family protein; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: B-box type zinc finger protein with CCT domain (TAIR:AT3G21880.1); Has 1471 Blast hits to 1456 proteins in 101 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1426; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control.
Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration due to higher accumulation of the second messenger, inositol (1,4,5)- triphosphate (IP(3)). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G27410.1); Has 135 Blast hits to 135 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Predicted AT-hook DNA-binding family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: Predicted AT-hook DNA-binding family protein (TAIR:AT4G12050.1); Has 813 Blast hits to 808 proteins in 45 species: Archae - 0; Bacteria - 6; Metazoa - 32; Fungi - 2; Plants - 764; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink).
Note that previous reports (Plant Cell 2003,15:1538; PNAS 2003, 100:13407) have incorrectly named AT5G37420 as AGL105. AT5G37415 has now been named as AGL105 based on Plant Cell 2003, 15:1538 where the GenBank accession number given for AGL105 is AY141227 (Supplemental Table 3), which corresponds to AT5G37415.
LIGHT SENSITIVE HYPOCOTYLS 4 (LSH4); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF640) (TAIR:AT2G31160.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
Encodes a nuclear localized protein with similarity to animal polycomb repressive core complex1 (PRC1) core component RING.Appears to function redundantly with ATRING1a, a close paralog. Both interact physically with CLF and LHP1 and appear to function together to repress class I KNOX gene expression.
Encodes a NAC-domain transcription factor with transcriptional activation activity that is involved in xylem formation. Induces transdifferentiation of various cells into protoxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids.
A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.
Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator.
Homologous to yeast SWI3 and a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3C, the other two members of the SWI3 family.
encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
TT8 is a regulation factor that acts in a concerted action with TT1, PAP1 and TTG1 on the regulation of flavonoid pathways, namely proanthocyanidin and anthocyanin biosynthesis. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Also important for important for marginal trichome development. It binds the promoter of both AT3G26790 and AT1G28300.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10.
Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF.
Encodes a nuclear localized protein with similarity to animal polycomb repressive core complex1 (PRC1) core component RING.Appears to function redundantly with ATRING1b, a close paralog. Both interact physically with CLF and LHP1 and appear to function together to repress class I KNOX gene expression.
Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule. Paralogous to GOA. Plays a maternal role in fertilization and seed development.
Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development.
Encodes a cold shock domain protein. Involved in cold acclimation by blocking the secondary structure of mRNA which in turn facilitates translation at cold temperature.
encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.
MGP is a nuclear-localized putative transcription factor with three zinc finger domains. MGP can interact with three proteins implicated in root patterning: SCR, SHR, and JKD in Y2H assays, and these interactions depend on the first zinc finger in MGP. MGP appears to be a direct transcriptional target of SHR and SCR, based on promoter binding assays, though it is not expressed in the QC, based on in situ hybridizations.
Involved in the regulation of salt stress. Expression of AtSAP18 is induced by NaCl, cold, drought, ABA, and ethylene treatment. AtSAP18 and HDA19 associate with ERF3 and ERF4 both in vitro and in vivo.
Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
This gene is a key regulator of the salicylic acid (SA)-mediated systemic acquired resistance (SAR) pathway. It is similar to the transcription factor inhibitor I kappa B, and contains ankyrin repeats. It confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Although transgenic Arabidopsis plants overexpressing NPR1 acquire enhanced sensitivity to SA and (benzothiadiazole) BTH, they display no obvious detrimental morphological changes and do not have elevated pathogenesis-related gene expression until activated by inducers or pathogens.
IDM1 is a histone H3 acetyltransferase that is capable of recognizing methylated DNA through its MBD domain and recognizing unmethylated histone H3K4 through its PHD domain. It negatively regulates DNA demethylation, preventing DNA hypermethylation of highly homologous multicopy genes and other repetitive sequences.
Arabidopsis NSN1 encodes a nucleolar GTP- binding protein and is required for maintenance of inflorescence meristem identity and floral organ development.
Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.
Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality.
Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions.
Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two.
Encodes a protein most similar to the POLTERGEIST locus. Double mutant analysis of loss of function alleles indicate PLL1 functions redundantly with POL to regulate meristem size and pedicel length. Acts in a dose dependent manner with POL to suppress the clv1, clv2 and clv3 phenotypes.
Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures.
Structurally similar to damaged DNA binding proteins. DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. DDB1a is shown to be RUB-modified.
Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function.
Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins.
ING1 encodes a member of the Inhibitor of Growth family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.
Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon.
REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA.
Encodes Lil3:1 (light-harvesting-like) protein. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. A generic LHC motif is present in Lil3:1.
Basic helix-loop-helix (bHLH) phytochrome interacting factor. Interacts specifically with the far-red light–absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. Role as negative regulator of phyB-mediated seedling deetiolation.
Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture.
Encodes HTA11, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA9) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z.
Encodes a protein similar to human SNAP50. Mutants display different temperature sensitivities in the dedifferentiation of cells from different organs. Mutation inhibits the dedifferentiation-associated accumulation of U-snRNAs and some other small RNA species encoded by independent-type genes carrying the USE and TATA box. Required for the elevation of cell proliferation competence in hypocotyl dedifferentiation.
protein kinase family protein; FUNCTIONS IN: two-component sensor activity, protein serine/threonine kinase activity, protein kinase activity, signal transducer activity, ATP binding; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent, two-component signal transduction system (phosphorelay); EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: PAC motif (InterPro:IPR001610), PAS fold (InterPro:IPR013767), PAS (InterPro:IPR000014), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), PAS-associated, C-terminal (InterPro:IPR000700), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: PAS domain-containing protein tyrosine kinase family protein (TAIR:AT3G06620.1); Has 127153 Blast hits to 125457 proteins in 4768 species: Archae - 339; Bacteria - 15978; Metazoa - 46871; Fungi - 11290; Plants - 33142; Viruses - 503; Other Eukaryotes - 19030 (source: NCBI BLink).
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
Putative transcription factor. Member of the floral homeotic AGAMOUS pathway.Mutations in HUA enhance the phenotype of mild ag-4 allele. Single hua mutants are early flowering and have reduced levels of FLC mRNA. Other MADS box flowering time genes such as FLM and MAF2 also appear to be regulated by HUA2. HUA2 normally activates FLC expression and enhances AG function. HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions.
Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response.
Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus.
JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine.
Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes.
Encodes a nuclear protein that acts in a phyB pathway (but downstream of phyB) and induces flowering in response to suboptimal light conditions. PFT1 promotes flowering in CO dependent and independent pathways and integrates several environmental stimuli, such as light quality and JA-dependent defenses. Mutants are hypo-responsive to far-red and hyper-responsive to red light and flower late under long day conditions. Also shown to be a Mediator subunit regulating jasmonate-dependent defense.
encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.
Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated.
Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding domain in C-terminus that prefers the sequence TTTAGGG.
Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46.
encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
Encodes a specialized sigma factor that functions in regulation of plastid genes and is responsible for the light-dependent transcription at the psbD LRP. Activation of SIG5 is dependent upon blue light and mediated by cryptochromes.
Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor.
This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation.
Encodes a putative MYB transcription factor involved in stomata development, loss of FLP activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants with MYB88. Its transcript levels change after inducing MUTE expression in a mute background.
Encodes a member of the BET subgroup of bromodomain proteins, a novel class of putative transcription factors. Its expression is induced during seed imbibition and downregulated during germination. Seeds of a loss-of-function mutant allele, imb1, show impaired cotyledon greening during germination in abscisic acid (ABA) and express higher levels of ABI5 protein than the wild type. Moreover, imb1 seeds are deficient in the phytochrome A (phyA)-mediated very-low-fluence response of germination.
Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant.
KH domain-containing protein / zinc finger (CCCH type) family protein; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein / zinc finger (CCCH type) family protein (TAIR:AT5G06770.1); Has 1306 Blast hits to 1045 proteins in 139 species: Archae - 0; Bacteria - 4; Metazoa - 726; Fungi - 40; Plants - 423; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink).
Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin.
R-protein-interacting protein that localizes to endosomes and functions in resistance gene–mediated immunity. Belongs to the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing.
Encodes LOF2 (LATERAL ORGAN FUSION2), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF1 (At1g26780).
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2
encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene.
Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses.
IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19.
Encodes a NAC-domain transcription factor involved in xylem formation. Induces transdifferentiation of various cells into metaxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230).
Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth.
Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation.
bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light
Encodes a telomeric DNA binding protein. In vitro, the protein preferentially binds double-stranded telomeric repeats, but it can also bind to the single G-rich telomeric strand.
Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development.
Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. The protein is localized to the nucleus and acts as a transcriptional repressor.
encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression.
This gene belongs to the family of SEP genes. It is involved in the development of sepals, petals, stamens and carpels. Additionally, it plays a central role in the determination of flower meristem and organ identity.
Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.
Putative transcription factor with zinc finger and helix-loop-helix domains, the later similar to HMG boxes. Involved in specifying abaxial cell fate in the carpel. Four putative LFY binding sites (CCANTG) and two potential binding sites for MADS box proteins known as CArG boxes (CC(A/T)6GG) were found in the region spanning 3.8 Kb upstream of the CRC coding region.
Encodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1.
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation.
BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT2G33720.1); Has 92 Blast hits to 55 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors.
Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation.
Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression.
Encodes a nuclear localized protein involved in far red light response signaling. Loss of function mutants are defective in far red light responses. Interacts with homologous gene FHY3.
Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500.
Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types.
Putative transcription factor, contains C2H2 domain, regulates aspects of shoot maturation in Arabidopsis thaliana. GIS loss-of-function mutations affect the epidermal differentiation of inflorescence organs, causing a premature decrease in trichome production on successive leaves, stem internodes, and branches. Overexpression has the opposite effect on trichome initiation and causes other heterochronic phenotypes, affecting flowering and juvenile–adult leaf transition and inducing the formation of rosette leaves on inflorescence stems.
Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL30 is expressed in pollen.It forms heterodimers with other MICK family members.
TATA-binding related factor (TRF) of subunit 20 of Mediator complex; FUNCTIONS IN: RNA polymerase II transcription mediator activity; INVOLVED IN: regulation of transcription from RNA polymerase II promoter; LOCATED IN: mediator complex; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit Med20 (InterPro:IPR013921); BEST Arabidopsis thaliana protein match is: TATA-binding related factor (TRF) of subunit 20 of Mediator complex (TAIR:AT2G28230.1); Has 80 Blast hits to 80 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
A cold-regulated gene whose product is targeted to the chloroplast. Cor15am protects stromal proteins from aggregation under various stress conditions. Constitutive expression increases freezing tolerance in protoplasts in vitro and chloroplasts in vivo. NMR and x-ray diffraction studies suggest that COR15a alters the intrinsic curvature of the inner membrane of chloroplast envelope. Late Embryogenesis abundant protein (LEA). Protects chloroplast membranes during freezing.
Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560).
Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation.
Encodes HTA9, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA11) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z.
Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling.
RPD3-like histone deacetylase. HDA6 mutations specifically increase the expression of auxin-responsive transgenes, suggesting a role in transgene silencing.
Encodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots.
Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes.
BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time.
Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays.
Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain.
B-box type zinc finger family protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: response to cold, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: B-box type zinc finger family protein (TAIR:AT4G27310.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
Encodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro.
F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
Copper transport protein family; BEST Arabidopsis thaliana protein match is: Heavy metal transport/detoxification superfamily protein (TAIR:AT5G52750.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.
Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor.
IBM1 likely encodes a protein with histone H3mK9 demethylation activity. It may preferentially demethylate H3mK9 at low-copy loci to protect them from silencing by nearby heterochromatin by preventing the spread of cytosine methylation. BONSAI (At1g73177) is hypermethylated in ibm1 mutants. ibm1 mutants have morphological defects that become apparent at the F3 generation, including small narrow leaves, arrested flower development, and faulty pollen development. These phenotypes cannot result solely from the BONSAI hypermethylation. Aberrant phenotypes in ibm1 mutants in both DNA methylation and plant development can be suppressed by mutations in the KYP H3K9 methyltransferase or he CMT3 non CG-cytosine methylase.
BEST Arabidopsis thaliana protein match is: TATA-binding related factor (TRF) of subunit 20 of Mediator complex (TAIR:AT2G28230.1); Has 37 Blast hits to 37 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a protein with 5-meC and thymine-DNA glycosylase activity with a preference for CpG and CpHpG sequences. Involved in maintaining methylation marks.
Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1.
Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves.
Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain.
Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway.
Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510).
Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy.
CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves.
Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled.
Encodes origin of replication complex 1a subunit.The protein contains a PHD domain,binds methylated DNA and appears to function as a transcriptional activator.
Encodes a class II HD-ZIP protein that regulates meristematic activity in different tissues, and that it is necessary for the correct formation of the gynoecium.
KH domain-containing protein / zinc finger (CCCH type) family protein; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein / zinc finger (CCCH type) family protein (TAIR:AT3G12130.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes RPT5b (Regulatory Particle 5b), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype.
Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development.
Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions.
The VERNALIZATION2 (VRN2) gene mediates vernalization and encodes a nuclear-localized zinc finger protein with similarity to Polycomb group (PcG) proteins of plants and animals. In wild-type Arabidopsis, vernalization results in the stable reduction of the levels of the floral repressor FLC. In vrn2 mutants, FLC expression is downregulated normally in response to vernalization, but instead of remaining low, FLC mRNA levels increase when plants are returned to normal temperatures. VRN2 maintains FLC repression after a cold treatment, serving as a mechanism for the cellular memory of vernalization. Required for complete repression of FLC. Required for the methylation of histone H3
A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Shi mutant is dominant, has dwarf phenotype. Loss of function mutations have no observable phenotype. Putative zinc finger protein. Involved in the response to gibberellic acid.
Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.
This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO.
Located on the SSL2 region of Arabidopsis thaliana, which is homeologous to the Brassica S locus for self incompatibility. Expressed in both vegetative and reproductive organs suggesting AtSP7 might not be involved in self incompatibility. Its expression is regulated during cell cycle progression through E2F transcription factors. The protein interacts with acetylated histones H3 and H4 and HAM acetyltransferases, proteins known to be involved in cell cycle control and DNA repair.
Encodes a member of the PHD-finger homeodomain protein family. The HAT3.1 homeodomain is highly divergent in sequence even at positions that are almost invariable among homeodomains. HAT3.1 shows a preference for the sequence T(A/G)(A/C)ACCA, different from those bound by other homeodomains.
Encodes a protein similar to the transcriptional regular of the animal Polycomb group and is involved in regulation of establishment of anterior-posterior polar axis in the endosperm and repression of flowering during vegetative phase. Mutation leads endosperm to develop in the absence of fertilization and flowers to form in seedlings and non-reproductive organs. Also exhibits maternal effect gametophytic lethal phenotype, which is suppressed by hypomethylation. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF) and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. In the ovule, the FIE transcript levels increase transiently just after fertilization.
Bromodomain containing nuclear-localized protein involved in leaf development. GTE6 binds to the promoter and intron of AS1 and regulates its expression via histone acetylation.
Member of the R2R3 factor gene family that acts as a cell-specific repressor of quiescent center (QC) divisions in the primary root, acting through the BR signaling pathway. Works with BES1 to regulate QC division in the root.
Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1.
AGL15 (AGAMOUS-Like 15) is a member of the MADS domain family of regulatory factors. Although AGL15 is preferentially expressed during embryogenesis, AGL15 is also expressed in leaf primordia, shoot apical meristems and young floral buds, suggesting that AGL15 may play a role during post-germinative development. Transgenic plants that ectopically express AGL15 show delays in the transition to flowering, perianth abscission and senescence and fruit and seed maturation. Role in embryogenesis and gibberellic acid catabolism. Targets B3 domain transcription factors that are key regulators of embryogenesis.
encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response.
Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Encodes a transcription factor involved in shoot apical meristem formation and auxin-mediated lateral root formation. The gene is thought not to be involved in stress responses (NaCl, auxins, ethylene). NAC1 (NAC1)
Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis.
Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin.
Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.
Identified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia.
SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro.
Encodes a SWI/SWF nuclear-localized chromatin remodeling factor of the CHD3 group. Involved in post-germination repression of embryonic development. Acts with GA to establish repression of embryonic genes upon germination. Protein preferentially accumulates in differentiating tissues. Loss of function alleles are associated with expression of embryonic traits in adult plants and derepression of embryonic genes such as PHEROS1. Is an extragenic suppressor of slr2 (SSL2). Mutations in PKL (SSL2) restores lateral root formation in the slr2 mutant slr-1. It was proposed that PKL/SSL2-mediated chromatin remodeling negatively regulates auxin-mediated LR formation in Arabidopsis.
HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles.
Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization.
Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization.
myb family transcription factor; BEST Arabidopsis thaliana protein match is: Duplicated homeodomain-like superfamily protein (TAIR:AT4G09450.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA.
Class I knotted-like homeodomain protein that is required for shoot apical meristem (SAM) formation during embryogenesis and for SAM function throughout the lifetime of the plant. Functions by preventing incorporation of cells in the meristem center into differentiating organ primordia.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Encodes pseudo-response regulator 3 (APRR3/PRR3). PRR3 transcript levels vary in a circadian pattern with peak expression at dusk under long and short day conditions. PRR3 affects the period of the circadian clock and seedlings with reduced levels of PRR3 have shorter periods, based on transcriptional assays of clock-regulated genes. PRR3 is expressed in the vasculature of cotyledons and leaves where it may help stabilize the TOC1 protein by preventing interactions between TOC1 and the F-box protein ZTL.
Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome.
Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA.
Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule.
Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues.
Required for expression of CBF-controlled cold-responsive genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. A maternally expressed imprinted gene.
B-box type zinc finger protein with CCT domain; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: B-box type zinc finger protein with CCT domain (TAIR:AT1G68520.1); Has 3476 Blast hits to 2333 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 3380; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).
Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain.
Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor.
Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members.
Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development.
Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages.
One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells.
a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction.
unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G31720.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Also named as CRF1 (cytokinin response factor 1).
Encodes a basic helix-loop-helix (bHLH) protein that controls meristemoid differentiation during stomatal development. In the absence of MUTE, meristemoids abort after excessive asymmetric divisions and fail to differentiate stomata. MUTE expression in the meristemoid is required for SLGCs differentiation as pavement cells. Epidermal cells lose their competence to respond to MUTE overexpression during cotyledon development.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT5G51590.1); Has 750 Blast hits to 746 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 748; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Encodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment.
Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes.
Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization.
AT-hook protein of GA feedback 1 (AGF1); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: Predicted AT-hook DNA-binding family protein (TAIR:AT1G76500.1); Has 970 Blast hits to 959 proteins in 100 species: Archae - 2; Bacteria - 77; Metazoa - 47; Fungi - 10; Plants - 766; Viruses - 3; Other Eukaryotes - 65 (source: NCBI BLink).
Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation.
Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. Ubiquitously expressed and localize to the nucleus.
Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots.
Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm.
Encodes a member of the KANADI family of putative transcription factors. Involved in integument formation during ovule development and expressed at the boundary between the inner and outer integuments. It is essential for directing laminar growth of the inner integument.Along with KAN1 and KAN2, KAN4 is involved in proper localization of PIN1 in early embryogenesis.
Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10–20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin.
Zinc finger C-x8-C-x5-C-x3-H type family protein; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: Zinc finger (CCCH-type) family protein (TAIR:AT1G32360.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
Encodes a nuclear protein that acts as a floral repressor and that functions within the thermosensory pathway. SVP represses FT expression via direct binding to the vCArG III motif in the FT promoter.
Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture.
LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors.
Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT-hook motif nuclear-localized protein 1 (TAIR:AT4G12080.1); Has 918 Blast hits to 910 proteins in 100 species: Archae - 0; Bacteria - 92; Metazoa - 24; Fungi - 29; Plants - 756; Viruses - 8; Other Eukaryotes - 9 (source: NCBI BLink).
homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis.
ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed specifically in the chalaza and in floral organ primordia.
Encodes a yeast CTR9 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast CTR9 is a component of a five-member PAF1 complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin.
Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway; mutant has deregulated expression of ASA1 in dominant allele. Loss of function allele suggests ATR1 also functions at a control point for regulating indole glucosinolate homeostasis.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT3G61310.1); Has 793 Blast hits to 789 proteins in 47 species: Archae - 0; Bacteria - 4; Metazoa - 23; Fungi - 13; Plants - 747; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis.
Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.
Transcriptional co-activator. Forms homodimers or heterodimers with the kiwi protein. Both proteins are involved in gene activation during pathogen defense and plant development.
A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root.
A member of Class II KN1-like homeodomain transcription factors factors (together with KNAT3 and KNAT4), with greatest homology to the maize knox1 homeobox protein. Regulates photomorphogenic responses and represses late steps in gibberellin biosynthesis. KNAT5 promoter activity showed cell-type specific pattern along longitudinal root axis, primarily in the epidermis of the distal end of primary root elongation zone.
Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins.
Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
Encodes a member of the AP2 family of transcriptional regulators. May be involved in germination and seedling growth. Mutants are resistant to ABA analogs and are resistant to high nitrogen concentrations.essential for the developmental transition between the embryonic and vegetative phases in plants. Overexpression results in the formation of somatic embryos on cotyledons. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions.
Homeobox gene controlling the stem cell pool. Expressed in the stem cell organizing center of meristems. Required to keep the stem cells in an undifferentiated state. Regulation of WUS transcription is a central checkpoint in stem cell control. The size of the WUS expression domain controls the size of the stem cell population through WUS indirectly activating the expression of CLAVATA3 (CLV3) in the stem cells and CLV3 repressing WUS transcription through the CLV1 receptor kinase signaling pathway. Repression of WUS transcription through AGAMOUS (AG) activity controls stem cell activity in the determinate floral meristem. Binds to TAAT element core motif. WUS is also involved in cell differentiation during anther development.
encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3.
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT4G17950.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported.
Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis.
bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus.
encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3¡¯s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2.
ovate family protein 16 (OFP16); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 12 (TAIR:AT1G05420.1); Has 251 Blast hits to 251 proteins in 22 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 235; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF.
Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid.
Domain of unknown function (DUF313) ; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT3G24850.1); Has 144 Blast hits to 144 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought.
Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance.
a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003).
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
Encodes a homeodomain-containing transcription factor that controls flowering. FWA is silenced in wild type plants and reverse of the imprinted silencing causes a late flowering phenotype. FWA gene contains two tandem repeats around the transcription start site that are necessary and sufficient for silencing via DNA methylation.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses. Functions as an E3 ligase required for the ubiquitination of ICE1. HOS1 physically interacts with ICE1 and mediates the ubiquitination of ICE1 both in vitro and in vivo. Overexpression represses the expression of CBFs and their downstream genes and confers increased sensitivity to freezing stress.
Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells.
Plant protein of unknown function (DUF868); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF868, plant (InterPro:IPR008586); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF868) (TAIR:AT2G27770.1); Has 289 Blast hits to 289 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 285; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT hook motif DNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif DNA-binding family protein (TAIR:AT5G46640.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
Encodes HTA8, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA9 and HTA11) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z.
PAS domain-containing protein tyrosine kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity, signal transducer activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PAC motif (InterPro:IPR001610), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), PAS fold (InterPro:IPR013767), PAS (InterPro:IPR000014), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: PAS domain-containing protein tyrosine kinase family protein (TAIR:AT3G06640.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes a nuclear localized R2R3-type MYB transcription factor that is involved in responses to abiotic stress including cold acclimation,osmotic and salt stress.Mutants are sensitive to salt, freezing and osmotic stress.
Encodes a protein similar to TATA-binding protein-associated factor TAF1 (a.k.a. TAFII250) with histone acetyltransferase activity. It is required in integrating light signals to regulate gene expression and growth.
novel interactor of JAZ (NINJA); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: ABI five binding protein 3 (TAIR:AT3G29575.4); Has 317 Blast hits to 301 proteins in 73 species: Archae - 2; Bacteria - 15; Metazoa - 43; Fungi - 39; Plants - 175; Viruses - 3; Other Eukaryotes - 40 (source: NCBI BLink).
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower
Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation.
Encodes a member of the Agamous-like family of transcription factors. Localized to the nucleus in the central cell and endosperm of the female gametophyte. Loss of function mutations show reduced female fertility. Fifty percent of ovules have defective central cells with abnormal morphology and patterns of gene expression. Upon fertilization 50% of seeds abort. Using yeast two hybrid assays AGL61 was shown to interact with AGL80, another MADS box gene with similar defects in ovule development. These data suggest that AGL61 and 80 together are required for proper differentiation of the central cell.
Encodes a telomeric DNA binding protein. In vitro, the protein preferentially binds double-stranded telomeric repeats, but it can also bind to the single G-rich telomeric strand.
Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele.
Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control.
encodes an SC35-like splicing factor of 30 kD that is localized to the nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926.
Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time.
Encodes a cytoplasmic dsRNA-binding protein DRB2. A maternally expressed imprinted gene. DRB2 and DRB4 have an antagonistic impact on polymerase IV-dependent siRNA levels.
Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin.
encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A.
Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA31 shares several residues with the conserved domain II region, believed to act as a degron in many of the rapidly degraded Aux/IAA family members. An IAA31 fusion protein is quite long-lived, but can be degraded more rapidly in the presence of auxin. Unlike many other family members, IAA31 transcript levels do not rise in response to auxin. Nevertheless, overexpression of IAA31 leads to defects in auxin-related processes such as gravitropism, root development, shoot development, and cotyledon vascular development.
Encodes XPB1, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies.
Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus.
One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated.
Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower
Arabidopsis thaliana putative c-myb-like transcription factor MYB3R-4. Functions in powdery mildew induced host endoreduplication at the site of infection.
A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts.
Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation. Also involved in defense gene transcription during plant immune responses.
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant.
encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
Encodes a MADs domain containing protein involved in promoting flowering. Loss of function mutations show delayed flowering in long days and reduced levels of LFY and AP1 expression.
This gene is predicted to encode a histone acetyltransferase. Five lines with RNAi constructs directed against HAF1 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation.
homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants.
PAS domain-containing protein tyrosine kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: PAC motif (InterPro:IPR001610), Protein kinase, catalytic domain (InterPro:IPR000719), PAS fold (InterPro:IPR013767), PAS (InterPro:IPR000014), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: PAS domain-containing protein tyrosine kinase family protein (TAIR:AT5G49470.3); Has 125703 Blast hits to 124182 proteins in 4625 species: Archae - 237; Bacteria - 14697; Metazoa - 46775; Fungi - 11283; Plants - 33084; Viruses - 499; Other Eukaryotes - 19128 (source: NCBI BLink).
Encodes a basic helix–loop–helix transcription factor that acts downstream of MP in root initiation. TMO7 protein moves to the hypophysis and to vascular cells, contributing to MP-dependent root formation. Promotes the correct definition of the hypophysis cell division plane.
Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.
Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization.
Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings.
Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with with both Rad51 and Dss1(I) or both Dmc1 and Dss1(I) in a tripartite complex.
OFP10; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 6 (TAIR:AT3G52525.1); Has 400 Blast hits to 400 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
Member of the R2R3 factor gene family. Expression is induced in response to dessication, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion.
member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3.
MADS-box protein encoded by FLOWERING LOCUS C - transcription factor that functions as a repressor of floral transition and contributes to temperature compensation of the circadian clock. Expression is downregulated during cold treatment. Vernalization, FRI and the autonomous pathway all influence the state of FLC chromatin. Both maternal and paternal alleles are reset by vernalization, but their earliest activation differs in timing and location. Histone H3 trimethylation at lysine 4 and histone acetylation are associated with active FLC expression, whereas histone deacetylation and histone H3 dimethylation at lysines 9 and 27 are involved in FLC repression. Expression is also repressed by two small RNAs (30- and 24-nt) complementary to the FLC sense strand 3? to the polyA site. The small RNAs are most likely derived from an antisense transcript of FLC. Interacts with SOC1 and FT chromatin in vivo. Member of a protein complex.
Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants.
Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression.
encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
Similar to the product of the Polycomb-group gene Enhancer of zeste. Required for stable repression of AG and AP3. Putative role in cell fate determination. Involved in the control of leaf morphogenesis. mutants exhibit curled, involute leaves. AGAMOUS and APETALA3 are ectopically expressed in the mutant.
ovate family protein 13 (OFP13); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 15 (TAIR:AT2G36050.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Encodes a nuclear-localized transcriptional activator with weak sequence similarity to basic helix-loop-helix(bHLH)-domain proteins. It promotes the production of stele cells in root meristems and is required to establish and maintain the normal vascular cell number and pattern in primary and lateral roots.
Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Thought to be involved in secondary cell wall metabolism.
Encodes a nuclear localized protein with similarity to transcriptional regulators. Recessive mutants are late flowering. Expression of LFY is reduced in LD mutants.
Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3.
Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype.
HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions.
Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter.
Encodes a MADS-box protein involved in flowering. Regulates the expression of SOC1 and is also upregulated by SOC1. Binds with IMK3 kinase domain. Phosphorylated by IMK3; likely to be a target for IMK3 kinase domain.
Encodes a protein that contains an SH2 domain. It can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is predicted to act as a transcription factor.
Encodes a histone acetyltransferase that is plays a role in the determination of the embryonic root-shoot axis. It is also required to regulate the floral meristem activity by modulating the extent of expression of WUS and AG. In other eukaryotes, this protein is recruited to specific promoters by DNA binding transcription factors and is thought to promote transcription by acetylating the N-terminal tail of histone H3. The enzyme has indeed been shown to catalyse primarily the acetylation of H3 histone with only traces of H4 and H2A/B being acetylated. Non-acetylated H3 peptide or an H3 peptide that had been previously acetylated on K9 both serve as excellent substrates for HAG1-catalyzed acetylation. However, prior acetylation of H3 lysine 14 blocks radioactive acetylation of the peptide by HAG1. HAG1 is specific for histone H3 lysine 14.
Encodes a general sigma factor in chloroplasts and is probably responsible for the recognition of sigma 70 type standard bacteria-type multi-subunit RNA polymerase (PEP) promoters in young cotyledons. It is a substrate for regulatory phosphorylation by cpCK2, a nuclear-coded plastid-targeted casein kinase 2, that has been implicated as a key component in plant sigma factor phosphorylation and transcriptional regulation.
Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays.
Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF7 represents a conserved upstream opening reading frame relative to major ORF AT2G31280.1
Encodes a basic leucine zipper (bZIP) transcription factor AtbZIP10. AtbZIP10 shuttles between the nucleus and the cytoplasm. It binds consensus G- and C-box DNA sequences. AtbZIP10 acts antagonistically with LSD1 in both pathogen-induced hypersensitive response and basal defense responses.
Encodes a chromatin-associated protein that specifically binds histones H3 and H4 and contributes to modulation of Arabidopsis chromatin structure and function.
Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression.
Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus.
Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development.
FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT5G38490.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2.
NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. NST1 promoter was detected in various tissues in which lignified secondary walls develop.
Encodes bZIP-transcription factor. Mutant plants have extra floral organs. PAN is essential for AG activation in early flowers of short-day-grown plants.
encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
Encodes GT-1, a plant transcription factor that binds to one of the cis-acting elements, BoxII, which resides within the upstream promoter region of light-responsive genes. GT-1 was assumed to act as a molecular switch modulated through Ca(2+)-dependent phosphorylation/dephosphorylation in response to light signals.
Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination.
The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression.
Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity.
Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.It is localized to the nucleus and acts as a transcriptional activator through the GCC-box. It has been identified as a suppressor of Bax-induced cell death by functional screening in yeast and can also suppress Bax-induced cell death in tobacco plants. Overexpression of this gene in tobacco BY-2 cells confers resistance to H2O2 and heat stresses. Overexpression in Arabidopsis causes upregulation of PDF1.2 and GST6. It is part of the ethylene signaling pathway and is predicted to act downstream of EIN2 and CTR1, but not under EIN3.
transcriptional factor B3 family protein; BEST Arabidopsis thaliana protein match is: Transcriptional factor B3 family protein (TAIR:AT2G16210.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development.
Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings.
Positive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching.
Chromatin Assembly Factor-1 (CAF-1) p60 subunit. Involved in organization of the shoot and root apical meristems. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis.
Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. This locus has been split into two based on data presented in PMID:22372440. The first annotated exon of the existing AT5G01310.1 model (TAIR10) with part of the first intron becomes a new locus AT5G01305 (encodes a bHLH proteins ROX1). The 3' part retains the original locus name: AT5G01310 (encodes APTX).
Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development.
Encodes a novel Arabidopsis KNOX gene that encodes a MEINOX domain but lacks the homeodomain and interacts with TALE-class homeodomain proteins to modulate their activities
Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.
AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation and increased susceptibility to bacterial pathogens.
Encodes a protein that is found in not only the eif3 complex but also in association with subunits of the COP9 signalosome. eIF3e appears to be subjected to proteasome-dependent degradation that requires the PCI domain of eIF3e. The level of eIF3e present in cells appears to affect the rate of translation.
Encodes the med21 subunit of the mediator complex which is involved in transcriptional regulation. MED21 interacts physically with the E3 ligase HUB1 and this interaction may be important in mediation defense responses to fungal pathogens.
encodes a PII protein that may function as part of a signal transduction network involved in perceiving the status of carbon and organic nitrogen. Forms a protein complex with N-acetylglutamate kinase and regulates the kinase activity by relieving the feedback inhibition of the kinase by arginine. Regulates acetyl-CoA carboxylase activity.
Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2.
Early Flowering 6 (ELF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a repressor in the photoperiod pathway. ELF6 interacts with BES1 in a Y2H assay, in vitro, and in Arabidosis protoplasts (based on BiFC). ELF6 may play a role in brassinosteroid signaling by affecting histone methylation in the promoters of BR-responsive genes.
Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth.
encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
Encodes an atypical member of the sHSP20 family that is involved in histone demethylation. Loss of function mutations show increased methylation. IMD2 co-localizes to the nucleus with, and physically interacts with, IMD1, a protein involved in RNA directed DNA methylation. IMD2 contains an alpha crystallin domain , that is required for its function.
Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. SPL activity nonautonomously inhibits initiation of new leaves at the shoot apical meristem.
BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G03170.1); Has 46 Blast hits to 46 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
